RIPPLY2 (NM_001009994) Human Untagged Clone

CAT#: SC301467

RIPPLY2 (untagged)-Human ripply2 homolog (zebrafish) (RIPPLY2)



  "NM_001009994" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
RIPPLY2 mouse monoclonal antibody, clone OTI1B5 (formerly 1B5)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C6orf159; dJ237I15.1; SCDO6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC301467 representing NM_001009994.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGAACGCGGGAGGCGCAGAGGGTACAGAGAGTGGAGCTGCGGCGTGCGCGGCCACCGACGGCCCT
ACGCGGCGCGCGGGCGCGGACTCCGGATACGCAGGCTTCTGGAGACCCTGGGTGGACGCCGGAGGCAAG
AAAGAAGAGGAGACGCCGAACCACGCCGCGGAGGCGATGCCCGATGGCCCTGGAATGACCGCAGCCTCA
GGAAAGCTTTACCAATTCAGGCACCCAGTCAGACTATTTTGGCCAAAATCAAAATGTTATGATTACTTA
TATCAAGAAGCAGAAGCTCTTCTGAAAAATTTTCCAATTCAAGCCACAATTTCATTTTATGAAGATTCT
GATAGCGAAGATGAAATTGAGGATCTGACCTGTGAAAATTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001009994
Insert Size 387 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001009994.2
RefSeq Size 674 bp
RefSeq ORF 387 bp
Locus ID 134701
UniProt ID Q5TAB7
MW 13.9 kDa
Gene Summary This gene encodes a nuclear protein that belongs to a novel family of proteins required for vertebrate somitogenesis. Members of this family have a tetrapeptide WRPW motif that is required for interaction with the transcriptional repressor Groucho and a carboxy-terminal Ripply homology domain/Bowline-DSCR-Ledgerline conserved region required for transcriptional repression. Null mutant mice die soon after birth and display defects in axial skeleton segmentation due to defective somitogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Transcript Variant: This variant (1) represents the longer transcript and encodes the protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...