ANKRD16 (NM_001009943) Human Untagged Clone

CAT#: SC301455

ANKRD16 (untagged)-Human ankyrin repeat domain 16 (ANKRD16), transcript variant 4



  "NM_001009943" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-ANKRD16 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC301455 representing NM_001009943.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCCAGCCCGGGGACCCGCGGCGCCTCTGCAGGCTGGTGCAGGAGGGCCGGCTGCGCGCCCTGAAG
GAGGAGCTGCAGGCGGCCGGGGGCTGCCCGGGGCCGGCCGGGGATACCCTCCTGCACTGCGCCGCGCGC
CACGGGCATCGGGACGTGCTGGCCTATCTGGCCGAGGCCTGGGGCATGGACATCGAGGCCACCAACCGA
GACTACAAGCGGCCTCTGCACGAGGCGGCCTCCATGGGCCACCGAGACTGCGTGCGCTACCTGCTGGGC
CGGGGGGCAGCGGTCGACTGCCTGAAGAAGGCCGACTGGACTCCTCTGATGATGGCCTGCACAAGGAAG
AACCTGGGGGTGATCCAGGAGCTGGTGGAACATGGCGCCAATCCACTCCTGAAGAACAAAGATGGCTGG
AACAGTTTCCACATTGCCAGTCGAGAAGGCGACCCTCTGATCCTCCAGTACCTGCTCACTGTTTGCCCA
GGTGCCTGGAAGACAGAGAGCAAAATTAGAAGGACTCCTCTGCATACTGCAGCAATGCATGGCCATTTG
GAGGCAGTCAAGGTGCTTCTTAAGAGGTGCCAATATGAACCAGACTACAGAGACAACTGTGGCGTCACC
GCCTTGATGGACGCAATCCAGTGTGGGCACATCGACGTCGCTAGGCTGCTCCTCGATGAACATGGGGCT
TGCCTTTCAGCAGAAGACAGCCTGGGTGCCCAGGCTCTGCACAGGGCAGCTGTCACAGGGCAGGACGAA
GCCATCCGATTCTTGGTCTCTGAACTTGGCGTCGATGTAGATGTGAGAGCCACATCAACCCACCTCACA
GCACTTCATTATGCAGCTAAGCCCTGCATCTGGCCTGTGCAGGTCAGCACTTGGCCTGTGCCAAGTTTC
TCCTGCAGTCGGGACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001009943
Insert Size 915 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001009943.2
RefSeq Size 1604 bp
RefSeq ORF 915 bp
Locus ID 54522
UniProt ID Q6P6B7
MW 33.4 kDa
Gene Summary Required to prevent the misactivation of serine (Ser) with tRNA(Ala) by promoting the hydrolysis of Ser-mischarged tRNA(Ala), thereby playing a role in translational fidelity. Binds directly to the catalytic domain of AARS/AlaRS and captures Ser that is misactivated by AARS/AlaRS, preventing the charging of Ser adenylates to tRNA(Ala) and precluding Ser misincorporation in nascent peptides.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) differs in the 3' UTR and lacks an alternate coding exon compared to variant 1, that causes a frameshift. The resulting isoform (c) is shorter and has a distinct C-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...