United States
Germany
Japan
United Kingdom
China
C20orf30 (TMEM230) (NM_001009925) Human Untagged Clone
CAT＃: SC301444
TMEM230 (untagged)-Human chromosome 20 open reading frame 30 (C20orf30), transcript variant 4
CNY 1,800.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C20orf30; dJ1116H23.2.1; HSPC274 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC301444 representing NM_001009925
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATGCCGTCCCGTACCAACCTGGCTACTGGAATCCCCAGTAGTAAAGTGAAATATTCAAGGCTCTCCA GCACAGACGATGGCTACATTGACCTTCAGTTTAAGAAAACCCCTCCTAAGATCCCTTATAAGGCCATCGC ACTTGCCACTGTGCTGTTTTTGATTGGCGCCTTTCTCATTATTATAGGCTCCCTCCTGCTGTCAGGCTAC ATCAGCAAAGGGGGGGCAGACCGGGCCGTTCCAGTGCTGATCATTGGCATTCTGGTGTTCCTACCCGGAT TTTACCACCTGCGCATCGCTTACTATGCATCCAAAGGCTACCGTGGTTACTCCTATGATGACATTCCAGA CTTTGATGACTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001009925 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001009925.1, NP_001009925.1 |
| RefSeq Size | 1468 bp |
| RefSeq ORF | 363 bp |
| Locus ID | 29058 |
| UniProt ID | Q96A57 |
| Protein Families | Transmembrane |
| Gene Summary | This gene encodes a multi-pass transmembrane protein that belongs to the TMEM134/TMEM230 protein family. The encoded protein localizes to secretory and recycling vesicle in the neuron and may be involved in synaptic vesicles trafficking and recycling. Mutations in this gene may be linked to familial Parkinson's disease. [provided by RefSeq, Mar 2017] Transcript Variant: This variant (4) lacks an exon in the 5' region, and uses a downstream AUG codon for translation initiation, as compared to variant 1. The encoded isoform (2) has a shorter N-terminus, as compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224414 | TMEM230 (Myc-DDK-tagged)-Human chromosome 20 open reading frame 30 (C20orf30), transcript variant 4 |
CNY 1,800.00 |
|
| RC224414L3 | Lenti ORF clone of Human chromosome 20 open reading frame 30 (C20orf30), transcript variant 4, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC224414L4 | Lenti ORF clone of Human chromosome 20 open reading frame 30 (C20orf30), transcript variant 4, mGFP tagged |
CNY 5,890.00 |
|
| RG224414 | TMEM230 (tGFP-tagged) - Human chromosome 20 open reading frame 30 (C20orf30), transcript variant 4 |
CNY 4,370.00 |
其它C20orf30产品
