C20orf30 (TMEM230) (NM_001009924) Human Untagged Clone
CAT#: SC301443
TMEM230 (untagged)-Human chromosome 20 open reading frame 30 (C20orf30), transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C20orf30; dJ1116H23.2.1; HSPC274 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC301443 representing NM_001009924.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGATGCCGTCCCGTACCAACCTGGCTACTGGAATCCCCAGTAGTAAAGTGAAATATTCAAGGCTCTCC AGCACAGACGATGGCTACATTGACCTTCAGTTTAAGAAAACCCCTCCTAAGATCCCTTATAAGGCCATC GCACTTGCCACTGTGCTGTTTTTGATTGGCGCCTTTCTCATTATTATAGGCTCCCTCCTGCTGTCAGGC TACATCAGCAAAGGGGGGGCAGACCGGGCCGTTCCAGTGCTGATCATTGGCATTCTGGTGTTCCTACCC GGATTTTACCACCTGCGCATCGCTTACTATGCATCCAAAGGCTACCGTGGTTACTCCTATGATGACATT CCAGACTTTGATGACTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001009924 |
Insert Size | 363 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001009924.1 |
RefSeq Size | 1792 bp |
RefSeq ORF | 363 bp |
Locus ID | 29058 |
UniProt ID | Q96A57 |
Protein Families | Transmembrane |
MW | 13.2 kDa |
Gene Summary | This gene encodes a multi-pass transmembrane protein that belongs to the TMEM134/TMEM230 protein family. The encoded protein localizes to secretory and recycling vesicle in the neuron and may be involved in synaptic vesicles trafficking and recycling. Mutations in this gene may be linked to familial Parkinson's disease. [provided by RefSeq, Mar 2017] Transcript Variant: This variant (2) has an additional segment in the 5' region and uses a downstream AUG codon for translation initiation, as compared to variant 1. The encoded isoform (2) has a shorter N-terminus, as compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213024 | TMEM230 (Myc-DDK-tagged)-Human chromosome 20 open reading frame 30 (C20orf30), transcript variant 2 |
CNY 1,200.00 |
|
RC213024L3 | Lenti ORF clone of Human chromosome 20 open reading frame 30 (C20orf30), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC213024L4 | Lenti ORF clone of Human chromosome 20 open reading frame 30 (C20orf30), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG213024 | TMEM230 (tGFP-tagged) - Human chromosome 20 open reading frame 30 (C20orf30), transcript variant 2 |
CNY 2,800.00 |
其它C20orf30产品