Legumain (LGMN) (NM_001008530) Human Untagged Clone

CAT#: SC301315

LGMN (untagged)-Human legumain (LGMN), transcript variant 2



  "NM_001008530" in other vectors (5)

CNY 7,220.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Legumain (LGMN) Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AEP; LGMN1; PRSC1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001008530, the custom clone sequence may differ by one or more nucleotides


ATGGTTTGGAAAGTAGCTGTATTCCTCAGTGTGGCCCTGGGCATTGGTGCCGTTCCTATAGATGATCCTG
AAGATGGAGGCAAGCACTGGGTGGTGATCGTGGCAGGTTCAAATGGCTGGTATAATTATAGGCACCAGGC
AGACGCGTGCCATGCCTACCAGATCATTCACCGCAATGGGATTCCTGACGAACAGATCGTTGTGATGATG
TACGATGACATTGCTTACTCTGAAGACAATCCCACTCCAGGAATTGTGATCAACAGGCCCAATGGCACAG
ATGTCTATCAGGGAGTCCCGAAGGACTACACTGGAGAGGATGTTACCCCACAAAATTTCCTTGCTGTGTT
GAGAGGCGATGCAGAAGCAGTGAAGGGCATAGGATCCGGCAAAGTCCTGAAGAGTGGCCCCCAGGATCAC
GTGTTCATTTACTTCACTGACCATGGATCTACTGGAATACTGGTTTTTCCCAATGAAGATCTTCATGTAA
AGGACCTGAATGAGACCATCCATTACATGTACAAACACAAAATGTACCGAAAGATGGTGTTCTACATTGA
AGCCTGTGAGTCTGGGTCCATGATGAACCACCTGCCGGATAACATCAATGTTTATGCAACTACTGCTGCC
AACCCCAGAGAGTCGTCCTACGCCTGTTACTATGATGAGAAGAGGTCCACGTACCTGGGGGACTGGTACA
GCGTCAACTGGATGGAAGATTCGGACGTGGAAGATCTGACTAAAGAGACCCTGCACAAGCAGTACCACCT
GGTAAAATCGCACACCAACACCAGCCACGTCATGCAGTATGGAAACAAAACAATCTCCACCATGAAAGTG
ATGCAGTTTCAGGGTATGAAACGCAAAGCCAGTTCTCCCGTCCCCCTACCTCCAGTCACACACCTTGACC
TCACCCCCAGCCCTGATGTGCCTCTCACCATCATGAAAAGGAAACTGATGAACACCAATGATCTGGAGGA
GTCCAGGCAGCTCACGGAGGAGATCCAGCGGCATCTGGATGCCAGGCACCTCATTGAGAAGTCAGTGCGT
AAGATCGTCTCCTTGCTGGCAGCGTCCGAGGCTGAGGTGGAGCAGCTCCTGTCCGAGAGAGCCCCGCTCA
CGGGGCACAGCTGCTACCCAGAGGCCCTGCTGCACTTCCGGACCCACTGCTTCAACTGGCACTCCCCCAC
GTACGAGTATGCGTTGAGACATTTGTACGTGCTGGTCAACCTTTGTGAGAAGCCGTATCCGCTTCACAGG
ATAAAATTGTCCATGGACCACGTGTGCCTTGGTCACTACTGA


Restriction Sites NotI-NotI     
ACCN NM_001008530
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001008530.1, NP_001008530.1
RefSeq Size 2166 bp
RefSeq ORF 1302 bp
Locus ID 5641
UniProt ID Q99538
Protein Families Druggable Genome, Protease
Protein Pathways Antigen processing and presentation, Lysosome
Gene Summary This gene encodes a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Enzyme activation is triggered by acidic pH and appears to be autocatalytic. Protein expression occurs after monocytes differentiate into dendritic cells. A fully mature, active enzyme is produced following lipopolysaccharide expression in mature dendritic cells. Overexpression of this gene may be associated with the majority of solid tumor types. This gene has a pseudogene on chromosome 13. Several alternatively spliced transcript variants have been described, but the biological validity of only two has been determined. These two variants encode the same isoform. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) has an additional exon in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...