TSPAN17 (NM_001006616) Human Untagged Clone

CAT#: SC301077

TSPAN17 (untagged)-Human tetraspanin 17 (TSPAN17), transcript variant 3



  "NM_001006616" in other vectors (4)

CN¥ 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00


TSPAN17 Antibody - N-terminal region
    • 100 ul

CN¥ 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FBX23; FBXO23; TM4SF17
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC301077 representing NM_001006616.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCCGGCAAGCACCAGCATTTCCAGGAACCTGAGGTCGGCTGCTGCGGGAAATACTTCCTGTTTGGC
TTCAACATTGTCTTCTGGGTGCTGGGAGCCCTGTTCCTGGCTATCGGCCTCTGGGCCTGGGGTGAGAAG
GGCGTTCTCTCGAACATCTCAGCGCTGACAGATCTGGGAGGCCTTGACCCCGTGTGGCTGTTTGTGGTA
GTTGGAGGCGTCATGTCGGTGCTGGGCTTTGCTGGCTGCATTGGGGCCCTCCGGGAGAACACCTTCCTG
CTCAAGTTTTTCTCCGTGTTCCTCGGTCTCATCTTCTTCCTGGAGCTGGCAACAGGGATCCTGGCCTTT
GTCTTCAAGGACTGGATTCGAGACCAGCTCAACCTCTTCATCAACAACAACGTCAAGGCCTACCGGGAC
GACATTGACCTCCAGAACCTCATTGACTTTGCTCAGGAATACTGGTCTTGCTGCGGAGCCCGAGGCCCC
AATGACTGGAACCTCAATATCTACTTCAACTGCACTGACTTGAACCCCAGCCGGGAGCGCTGCGGGGTG
CCCTTCTCCTGCTGCGTCAGGGACCCTGCGGAGGATGTCCTCAACACCCAGTGTGGCTACGACGTCCGG
CTCAAACTGGAGCTGGAGCAGCAGGGCTTCATCCACACCAAAGGCTGCGTGGGCCAGTTTGAGAAGTGG
CTGCAGGACAACCTGATTGTGGTGGCGGGAGTCTTCATGGGCATCGCCCTCCTCCAGATCTTTGGCATC
TGCCTGGCCCAGAACCTCGAGCAAATGGAATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001006616
Insert Size 792 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001006616.2
RefSeq Size 2564 bp
RefSeq ORF 792 bp
Locus ID 26262
UniProt ID Q96FV3
Protein Families Transmembrane
MW 29.6 kDa
Gene Summary This gene encodes a member of the transmembrane 4 superfamily. It is characterized by four tetraspanin transmembrane segments. The function of this gene has not yet been determined. [provided by RefSeq, Mar 2014]
Transcript Variant: This variant (3) uses an alternate in-frame splice site in the central coding region, and an alternate splice site that causes a frameshift in the 3' coding region, compared to variant 1. The resulting isoform (c) has a distinct C-terminus and is shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...