SIAH1 (NM_001006610) Human Untagged Clone

CAT#: SC301071

SIAH1 (untagged)-Human seven in absentia homolog 1 (Drosophila) (SIAH1), transcript variant 2



  "NM_001006610" in other vectors (6)

CN¥ 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00


SIAH1 rabbit polyclonal antibody
    • 25 ul

CN¥ 800.00
CN¥ 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BURHAS; SIAH1A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC301071 representing NM_001006610.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACGGGAAAGGCTACTCCACCTTCTCTGTACTCCTGGAGGGGAGTCTTGTTCACATGTTTACCAGCG
GCCAGGACAAGGAAGAGAAAAGAAATGAGCCGTCAGACTGCTACAGCATTACCTACCGGTACCTCGAAG
TGTCCACCATCCCAGAGGGTGCCTGCCCTGACTGGCACAACTGCATCCAACAATGACTTGGCGAGTCTT
TTTGAGTGTCCAGTCTGCTTTGACTATGTGTTACCGCCCATTCTTCAATGTCAGAGTGGCCATCTTGTT
TGTAGCAACTGTCGCCCAAAGCTCACATGTTGTCCAACTTGCCGGGGCCCTTTGGGATCCATTCGCAAC
TTGGCTATGGAGAAAGTGGCTAATTCAGTACTTTTCCCCTGTAAATATGCGTCTTCTGGATGTGAAATA
ACTCTGCCACACACAGAAAAAGCAGACCATGAAGAGCTCTGTGAGTTTAGGCCTTATTCCTGTCCGTGC
CCTGGTGCTTCCTGTAAATGGCAAGGCTCTCTGGATGCTGTAATGCCCCATCTGATGCATCAGCATAAG
TCCATTACAACCCTACAGGGAGAGGATATAGTTTTTCTTGCTACAGACATTAATCTTCCTGGTGCTGTT
GACTGGGTGATGATGCAGTCCTGTTTTGGCTTTCACTTCATGTTAGTCTTAGAGAAACAGGAAAAATAC
GATGGTCACCAGCAGTTCTTCGCAATCGTACAGCTGATAGGAACACGCAAGCAAGCTGAAAATTTTGCT
TACCGACTTGAGCTAAATGGTCATAGGCGACGATTGACTTGGGAAGCGACTCCTCGATCTATTCATGAA
GGAATTGCAACAGCCATTATGAATAGCGACTGTCTAGTCTTTGACACCAGCATTGCACAGCTTTTTGCA
GAAAATGGCAATTTAGGCATCAATGTAACTATTTCCATGTGTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001006610
Insert Size 942 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001006610.1
RefSeq Size 2393 bp
RefSeq ORF 942 bp
Locus ID 6477
UniProt ID Q8IUQ4
Protein Families Druggable Genome
Protein Pathways p53 signaling pathway, Ubiquitin mediated proteolysis, Wnt signaling pathway
MW 34.6 kDa
Gene Summary This gene encodes a protein that is a member of the seven in absentia homolog (SIAH) family. The protein is an E3 ligase and is involved in ubiquitination and proteasome-mediated degradation of specific proteins. The activity of this ubiquitin ligase has been implicated in the development of certain forms of Parkinson's disease, the regulation of the cellular response to hypoxia and induction of apoptosis. Alternative splicing results in several additional transcript variants, some encoding different isoforms and others that have not been fully characterized. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) includes an alternate 5' exon and uses an upstream AUG compared to variant 1. The resulting protein (isoform b) is longer and has a distinct N-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...