Sumo 2 (SUMO2) (NM_001005849) Human Untagged Clone

CAT#: SC301039

SUMO2 (untagged)-Human SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) (SUMO2), transcript variant 2



  "NM_001005849" in other vectors (6)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


SUMO2/3 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HSMT3; Smt3A; SMT3B; SMT3H2; SUMO3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC301039 representing NM_001005849.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCGACGAAAAGCCCAAGGAAGGAGTCAAGACTGAGAACAACGATCATATTAATTTGAAGGTGGCG
GGGCAGGATGGTTCTGTGGTGCAGTTTAAGATTAAGAGGCATACACCACTTAGTAAACTAATGAAAGCC
TATTGTGAACGACAGTTGGAAATGGAGGATGAAGATACAATTGATGTGTTCCAACAGCAGACGGGAGGT
GTCTACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001005849
Insert Size 216 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001005849.1
RefSeq Size 994 bp
RefSeq ORF 216 bp
Locus ID 6613
UniProt ID P61956
Protein Families Druggable Genome
MW 8.1 kDa
Gene Summary This gene encodes a protein that is a member of the SUMO (small ubiquitin-like modifier) protein family. It functions in a manner similar to ubiquitin in that it is bound to target proteins as part of a post-translational modification system. However, unlike ubiquitin which targets proteins for degradation, this protein is involved in a variety of cellular processes, such as nuclear transport, transcriptional regulation, apoptosis, and protein stability. It is not active until the last two amino acids of the carboxy-terminus have been cleaved off. Numerous pseudogenes have been reported for this gene. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an in-frame coding exon compared to variant 1, resulting in a shorter isoform (b), compared to isoform a. The amino acid sequence of isoform b is predicted and has not been experimentally verified.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...