United States
Germany
Japan
United Kingdom
China
PLAUR (NM_001005377) Human Untagged Clone
CAT＃: SC300934
PLAUR (untagged)-Human plasminogen activator, urokinase receptor (PLAUR), transcript variant 3
CNY 2,400.00
CNY 6,270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CD87; U-PAR; UPAR; URKR |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_001005377 edited
CCTTCCTGAGGCCAGAAGGAGAGAAGACGTGCAGGGACCCCGCGCACAGGAGCTGCCCTC GCGACATGGGTCACCCGCCGCTGCTGCCGCTGCTGCTGCTGCTCCACACCTGCGTCCCAG CCTCTTGGGGCCTGCGGTGCATGCAGTGTAAGACCAACGGGGATTGCCGTGTGGAAGAGT GCGCCCTGGGACAGGACCTCTGCAGGACCACGATCGTGCGCTTGTGGGAAGAAGGAGAAG AGCTGGAGCTGGTGGAGAAAAGCTGTACCCACTCAGAGAAGACCAACAGGACCCTGAGCT ATCGGACTGGCTTGAAGATCACCAGCCTTACCGAGGTTGTGTGTGGGTTAGACTTGTGCA ACCAGGGCAACTCTGGCCGGGCTGTCACCTATTCCCGAAGCCGTTACCTCGAATGCATTT CCTGTGGCTCATCAGACATGAGCTGTGAGAGGGGCCGGCACCAGAGCCTGCAGTGCCGCA GCCCTGAAGAACAGTGCCTGGATGTGGTGACCCACTGGATCCAGGAAGGTGAAGAAGTCC TGGAGCTTGAAAATCTGCCGCAGAATGGCCGCCAGTGTTACAGCTGCAAGGGGAACAGCA CCCATGGATGCTCCTCTGAAGAGACTTTCCTCATTGACTGCCGAGGCCCCATGAATCAAT GTCTGGTAGCCACCGGCACTCACGAACCGAAAAACCAAAGCTATATGGTAAGAGGCTGTG CAACCGCCTCAATGTGCCAACATGCCCACCTGGGTGACGCCTTCAGCATGAACCACATTG ATGTCTCCTGCTGTACTAAAAGTGGCTGTAACCACCCAGACCTGGATGTCCAGTACCGCA GTGGGGCTGCTCCTCAGCCTGGCCCTGCCCATCTCAGCCTCACCATCACCCTGCTAATGA CTGCCAGACTGTGGGGAGGCACTCTCCTCTGGACCTAAACCTGAAATCCCCCTCTCTGCC CTGGCTGGATCCGGGGGACCCCTTTGCCCTTCCCTCGGCTCCCAGCCCTACAGACTTGCT GTGTGACCTCAGGCCAGTGTGCCGACCTCTCTGGGCCTCAGTTTTCCCAGCTATGAAAAC AGCTATCTCACAAAGTTGTGTGAAGCAGAAGAGAAAAGCTGGAGGAAGGCCGTGGGCCAA TGGGAGAGCTCTTGTTATTATTAATATTGTTGCCGCTGTTGTGTTGTTGTTATTAATTAA AAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001005377 |
| Insert Size | 1200 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001005377.1, NP_001005377.1 |
| RefSeq Size | 1413 bp |
| RefSeq ORF | 873 bp |
| Locus ID | 5329 |
| UniProt ID | Q03405 |
| Protein Families | Druggable Genome, Secreted Protein |
| Protein Pathways | Complement and coagulation cascades |
| Gene Summary | This gene encodes the receptor for urokinase plasminogen activator and, given its role in localizing and promoting plasmin formation, likely influences many normal and pathological processes related to cell-surface plasminogen activation and localized degradation of the extracellular matrix. It binds both the proprotein and mature forms of urokinase plasminogen activator and permits the activation of the receptor-bound pro-enzyme by plasmin. The protein lacks transmembrane or cytoplasmic domains and may be anchored to the plasma membrane by a glycosyl-phosphatidylinositol (GPI) moiety following cleavage of the nascent polypeptide near its carboxy-terminus. However, a soluble protein is also produced in some cell types. Alternative splicing results in multiple transcript variants encoding different isoforms. The proprotein experiences several post-translational cleavage reactions that have not yet been fully defined. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) lacks one exon in the coding region and encodes an isoleucine rather than a valine following the splice site, compared to variant 1. Variant 3 encodes isoform 3 which is longer and lacks one of three LU (Ly-6 antigen/uPA receptor-like) domains, compared to isoform 2. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC215350 | PLAUR (Myc-DDK-tagged)-Human plasminogen activator, urokinase receptor (PLAUR), transcript variant 3 |
CNY 2,400.00 |
|
| RC215350L1 | Lenti ORF clone of Human plasminogen activator, urokinase receptor (PLAUR), transcript variant 3, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC215350L2 | Lenti ORF clone of Human plasminogen activator, urokinase receptor (PLAUR), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
| RC215350L3 | Lenti ORF clone of Human plasminogen activator, urokinase receptor (PLAUR), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC215350L4 | Lenti ORF clone of Human plasminogen activator, urokinase receptor (PLAUR), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
| RG215350 | PLAUR (tGFP-tagged) - Human plasminogen activator, urokinase receptor (PLAUR), transcript variant 3 |
CNY 4,370.00 |
