OR6M1 (NM_001005325) Human Untagged Clone
CAT#: SC300900
OR6M1 (untagged)-Human olfactory receptor, family 6, subfamily M, member 1 (OR6M1)
CNY 2,400.00
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | OR11-271 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001005325 edited
TTCTTCAGGGAAACCCTGCCCACCATATAGTAGTTGTCATGGGAAACTGGAGCACTGTGA CTGAAATCACCCTAATTGCCTTCCCAGCTCTCCTGGAGATTCGAATATCTCTCTTCGTGG TTCTTGTGGTAACTTACACATTAACAGCAACAGGAAACATCACCATCATCTCCCTGATAT GGATTGATCATCGCCTGCAAACTCCAATGTACTTCTTCCTCAGTAATTTGTCCTTTCTGG ATATCTTATACACCACTGTCATTACCCCAAAGTTGTTGGCCTGCCTCCTAGGAGAAGAGA AAACCATATCTTTTGCTGGTTGCATGATCCAAACATATTTCTACTTCTTTCTGGGGACGG TGGAGTTTATCCTCTTGGCGGTGATGTCCTTTGACCGCTACATGGCTATCTGCGACCCAC TGCACTACACGGTCATCATGAACAGCAGGGCCTGCCTTCTGCTGGTTCTGGGATGCTGGG TGGGAGCCTTCCTGTCTGTGTTGTTTCCAACCATTGTAGTGACAAGGCTACCTTACTGTA GGAAAGAAATTAATCATTTCTTCTGTGACATTGCCCCTCTTCTTCAGGTGGCCTGTATAA ATACTCACCTCATTGAGAAGATAAACTTTCTCCTCTCTGCCCTTGTCATCCTGAGCTCCC TGGCATTCACTACTGGGTCCTACGTGTACATAATTTCTACCATCCTGCGTATCCCCTCCA CCCAGGGCCGTCAGAAAGCTTTTTCTACCTGTGCTTCTCACATCACTGTTGTCTCCATTG CCCACGGGAGCAACATCTTTGTGTATGTGAGACCCAATCAGAACTCCTCACTGGATTATG ACAAGGTGGCCGCTGTCCTCATCACAGTGGTGACCCCTCTCCTGAACCCTTTTATCTACA GCTTGAGGAATGAGAAGGTACAGGAAGTGTTGAGAGAGACAGTGAACAGAATCATGACCT TGATACAAAGGAAAACTTGACACTGGTATACACTACATTAAATACATTTCTTTTTTTATT ATTTTTTTTAAGTTCCAGGGTACATGTGCAGGA |
Restriction Sites | Please inquire |
ACCN | NM_001005325 |
Insert Size | 1000 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001005325.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001005325.1, NP_001005325.1 |
RefSeq Size | 942 bp |
RefSeq ORF | 942 bp |
Locus ID | 390261 |
UniProt ID | Q8NGM8 |
Protein Families | Transmembrane |
Protein Pathways | Olfactory transduction |
Gene Summary | Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214544 | OR6M1 (Myc-DDK-tagged)-Human olfactory receptor, family 6, subfamily M, member 1 (OR6M1) |
CNY 2,400.00 |
|
RC214544L3 | Lenti ORF clone of Human olfactory receptor, family 6, subfamily M, member 1 (OR6M1), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC214544L4 | Lenti ORF clone of Human olfactory receptor, family 6, subfamily M, member 1 (OR6M1), mGFP tagged |
CNY 5,890.00 |
|
RG214544 | OR6M1 (tGFP-tagged) - Human olfactory receptor, family 6, subfamily M, member 1 (OR6M1) |
CNY 4,370.00 |