SP140 (NM_001005176) Human Untagged Clone

CAT#: SC300816

SP140 (untagged)-Human SP140 nuclear body protein (SP140), transcript variant 2



  "NM_001005176" in other vectors (4)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal SP140 Antibody (Center)
    • 400 ul

CNY 6,160.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms LYSP100; LYSP100-A; LYSP100-B
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001005176 edited
CTTTGACTGAGCACCGAGGGGCAGTTGGCAGCTTCACCTCAGAGCTGCAGGAAGGAACGG
GGCAGTGAAAATCGAATCGGGTGTGATCCTAGGCCAAGCTCATGGCCCAGCAGGGCCAGC
AGGGGCAGATGGCAAGTGGAGACAGCAATCTCAACTTCAGGATGGTCGCAGAGATCCAGA
ACGTAGAGGGTCAGAACCTGCAGGAGCAGGTTTGCCCTGAGCCCATTTTCAGGTTCTTCA
GAGAAAACAAGGTGGAGATTGCAAGTGCAATAACAAGGCCATTTCCTTTCCTTATGGGCC
TCCGAGACCGCTCCTTCATCTCCGAGCAGATGTATGAACATTTTCAAGAAGCTTTTAGAA
ACCTGGTCCCAGTGACAAGAGTGATGTATTGTGTACTCAGTGAACTGGAGAAGACATTTG
GCTGGTCACATCTGGAAGCATTGTTCAGCAGGATTAACCTGATGGCCTATCCTGATTTAA
ACGAGATTTACAGAAGCTTCCAGAATGAAAATTTATCATCCAGTGCAGTCCTGTGTCAAC
TTGTTTCTCCAAACAAAGACTGGAGAAGTCACGAAGAGAGCCTAGCACATACTGGTACAC
TGAGGAGGAGCTGCATGTGAAAGCTATGAAGACAGAAAAGGGGGTTGGTGGGGGCCTTTC
CGAACCATGTGGTTGAATTGCAGACTGTGGGAGGCAGGGTGTGAGAGCTGACTCTGGAGA
AAGAAGTTGAAGTGGATTCTGGAAGGCTTGACACCCTGTGCTAAGGAATCTGGAGTTTAA
TTTTTGGAAAATAAAGAAGGAATAAAGGGCATTTAAACGGGAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_001005176
Insert Size 800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001005176.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001005176.1, NP_001005176.1
RefSeq Size 853 bp
RefSeq ORF 519 bp
Locus ID 11262
UniProt ID Q13342
Protein Families Druggable Genome, Transcription Factors
Gene Summary This gene encodes a member of the SP100 family of proteins, which are share common domains including an N-terminal homogeneously staining region domain followed by a SP100/autoimmune regulator/NucP41/P75/deformed epidermal autoregulatory factor domain, a plant homeobox zinc finger, and a bromodomain. The encoded protein is interferon-inducible and is expressed at high levels in the nuclei of leukocytes. Variants of this gene have been associated with multiple sclerosis, Crohn's disease, and chronic lymphocytic leukemia. Alternative splicing results in multiple variants. [provided by RefSeq, Aug 2016]
Transcript Variant: This variant (2) lacks multiple 3' exons, and has an alternate 3' sequence, as compared to variant 1. The encoded isoform 2 is much shorter and has a distinct C-terminus, as compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...