TAFA3 (NM_001004440) Human Untagged Clone
CAT#: SC300684
FAM19A3 (untagged)-Human family with sequence similarity 19 (chemokine (C-C motif)-like), member A3 (FAM19A3), transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FAM19A3; TAFA-3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC300684 representing NM_001004440.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGTGAGAGGGTCGAGCGGAACTGGAGCACGGGCGGCTGGCTGCTGGCACTGTGCCTGGCCTGGCTG TGGACCCACCTGACCTTGGCTGCCTTGCAGCCTCCCACTGCCACAGTGCTTGTGCAGCAGGGCACCTGC GAGGTGATTGCGGCTCACCGCTGCTGCAACCGGAACCGCATCGAGGAGCGCTCCCAGACGGTGAAATGC TCCTGTTTTTCTGGCCAGGTGGCCGGCACCACGCGGGCAAAGCCCTCCTGCGTGGACGACCTGCTCTTG GCTGCCCACTGTGCTCGTAGAGACCCTAGAGCTGCACTCCGCCTCCTGCTCCCACAGCCTCCATCGTCC TGCAGAGATGGTGGTGTCAGATGGAGCCCTGCCTGCCGGGGGAGGAGTGTAAGGTGCTCCCGGACCTGT CGGGATGGAGCTGCAGCAGTGGACACAAAGTCAAAACCACCAAGGTCACACGATAGCTCTTGGGGGTCA CGGCCTGGACAAGAAAGGCTTGACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001004440 |
Insert Size | 510 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001004440.1 |
RefSeq Size | 1144 bp |
RefSeq ORF | 510 bp |
Locus ID | 284467 |
UniProt ID | Q7Z5A8 |
Protein Families | Secreted Protein, Transmembrane |
MW | 18.5 kDa |
Gene Summary | This gene is a member of the TAFA family which is composed of five highly homologous genes that encode small secreted proteins. These proteins contain conserved cysteine residues at fixed positions, and are distantly related to MIP-1alpha, a member of the CC-chemokine family. The TAFA proteins are predominantly expressed in specific regions of the brain, and are postulated to function as brain-specific chemokines or neurokines, that act as regulators of immune and nervous cells. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011] Transcript Variant: This variant (2) uses an alternate splice site in the coding region, which results in a frameshift compared to variant 1. The encoded isoform (2) is longer and has a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215659 | FAM19A3 (Myc-DDK-tagged)-Human family with sequence similarity 19 (chemokine (C-C motif)-like), member A3 (FAM19A3), transcript variant 2 |
CNY 2,400.00 |
|
RC215659L3 | Lenti ORF clone of Human family with sequence similarity 19 (chemokine (C-C motif)-like), member A3 (FAM19A3), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC215659L4 | Lenti ORF clone of Human family with sequence similarity 19 (chemokine (C-C motif)-like), member A3 (FAM19A3), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG215659 | FAM19A3 (tGFP-tagged) - Human family with sequence similarity 19 (chemokine (C-C motif)-like), member A3 (FAM19A3), transcript variant 2 |
CNY 4,000.00 |