CLEC2D (NM_001004419) Human Untagged Clone

CAT#: SC300674

CLEC2D (untagged)-Human C-type lectin domain family 2, member D (CLEC2D), transcript variant 2



  "NM_001004419" in other vectors (6)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-CLEC2D Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CLAX; LLT1; OCIL
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC300674 representing NM_001004419.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCATGACAGTAACAATGTGGAGAAAGACATTACACCATCTGAATTGCCTGCAAACCCAGGTTGTCTG
CATTCAAAAGAGCATTCTATTAAAGCTACCTTAATTTGGCGCTTATTTTTCTTAATCATGTTTCTGACA
ATCATAGTGTGTGGAATGGTTGCTGCTTTAAGCGCAATAAGAGCTAACTGCCATCAAGAGCCATCAGTA
TGTCTTCAAGCTGCATGCCCAGAAAGCTGGATTGGTTTTCAAAGAAAGTGTTTCTATTTTTCTGATGAC
ACCAAGAACTGGACATCAAGTCAGAGGTTTTGTGACTCACAAGATGCTGATCTTGCTCAGGTTGAAAGC
TTCCAGGAACTGAATTTCCTGTTGAGATATAAAGGCCCATCTGATCACTGGATTGGGCTGAGCAGAGAA
CAAGGCCAACCATGGAAATGGATAAATGGTACTGAATGGACAAGACAGTTAGTCATGAAAGAAGATGGT
GCCAACTTGTATGTTGCAAAGGTTTCACAAGTTCCTCGAATGAATCCAAGACCTGTCATGGTTTCCTAT
CCTGGGAGCAGGAGAGTGTGCCTATTTGAATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001004419
Insert Size 585 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001004419.4
RefSeq Size 5366 bp
RefSeq ORF 585 bp
Locus ID 29121
UniProt ID Q9UHP7
Protein Families Druggable Genome, Transmembrane
MW 22.3 kDa
Gene Summary This gene encodes a member of the natural killer cell receptor C-type lectin family. The encoded protein inhibits osteoclast formation and contains a transmembrane domain near the N-terminus as well as the C-type lectin-like extracellular domain. Several alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Oct 2010]
Transcript Variant: This variant (2) includes an additional exon, compared to variant 1, that causes a frameshift. The resulting isoform (2) is longer and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...