CD64 (FCGR1B) (NM_001004340) Human Untagged Clone
CAT#: SC300657
FCGR1B (untagged)-Human Fc fragment of IgG, high affinity Ib, receptor (CD64) (FCGR1B), transcript variant 2
CNY 3,600.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD64b; FCG1; FcgammaRIa; FCGR1; FCGR1A; FcRI; IGFR1; IGFRB |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001004340 edited
ATGTGGTTCTTGACAACTCTGCTCCTTTGGGGCTGGCTACTACTGCAGGTCTCCAGCAGA GTCTTCACGGAAGGAGAACCTCTGGCCTTGAGGTGTCATGCGTGGAAGGATAAGCTGGTG TACAATGTGCTTTACTATCGAAATGGCAAAGCCTTTAAGTTTTTCCACTGGAATTCTAAC CTCACCATTCTGAAAACCAACATAAGTCACAATGGCACCTACCATTGCTCAGGCATGGGA AAGCATCGCTACACATCAGCAGGAATATCACAATACACTGTGAAAGGCCTCCAGTTACCA ACTCCTGTCTGGTTTCATGTCCTTTTCTATCTGGCAGTGGGAATAATGTTTTTAGTGAAC ACTGTTCTCTGGGTGACAATACGTAAAGAACTGAAAAGAAAGAAAAAGTGGAATTTAGAA ATCTCTTTGGATTCTGGTCATGAGAAGAAGGTAATTTCCAGCCTTCAAGAAGACAGACAT TTAGAAGAAGAGCTGAAATGTCAGGAACAAAAAGAAGAACAGCTGCAGGAAGGGGTGCAC CGGAAGGAGCCCCAGGGGGCCACGTAG |
Restriction Sites | Please inquire |
ACCN | NM_001004340 |
Insert Size | 800 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The open reading frame of this clone has been fully sequenced and found three SNPs within the protein associated with this reference, NM_001004340.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001004340.1, NP_001004340.1 |
RefSeq Size | 570 bp |
RefSeq ORF | 567 bp |
Locus ID | 2210 |
UniProt ID | Q92637 |
Protein Families | Transmembrane |
Gene Summary | Three distinct, but closely related classes of receptors that bind the Fc portion of IgG have been identified (Fcgamma RI, II and III). The FcgammaRI family consists of three closely related genes termed A, B, and C. This gene likely encodes a non-functional protein that is not detectable at the cell surface and binds ligand with low affinity. [provided by RefSeq, Nov 2019] Transcript Variant: This variant (2, also known as B2) lacks two consecutive in-frame coding exons compared to variant 1. This results in a shorter isoform (2) missing an internal protein segment compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219204 | FCGR1B (Myc-DDK-tagged)-Human Fc fragment of IgG, high affinity Ib, receptor (CD64) (FCGR1B), transcript variant 2 |
CNY 3,600.00 |
|
RC219204L3 | Lenti ORF clone of Human Fc fragment of IgG, high affinity Ib, receptor (CD64) (FCGR1B), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC219204L4 | Lenti ORF clone of Human Fc fragment of IgG, high affinity Ib, receptor (CD64) (FCGR1B), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG219204 | FCGR1B (tGFP-tagged) - Human Fc fragment of IgG, high affinity Ib, receptor (CD64) (FCGR1B), transcript variant 2 |
CNY 5,200.00 |