United States
Germany
Japan
United Kingdom
China
RNASEK (NM_001004333) Human Untagged Clone
CAT＃: SC300651
RNASEK (untagged)-Human ribonuclease, RNase K (RNASEK), transcript variant 1
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001004333 edited
CTGCGAGGGCATCCTGGGCTTTCTCCCACCGCTTTCCGAGCCCGCTTGCACCTCGGCGAT CCCCGACTCCCTTCTTTATGGCGTCGCTCCTGTGCTGTGGGCCGAAGCTGGCCGCCTGCG GCATCGTCCTCAGCGCCTGGGGAGTGATCATGTTGATAATGCTCGGAATATTTTTCAATG TTCATTCCGCTGTGTTGATTGAGGACGTTCCCTTCACGGAGAAAGATTTTGAGAATGGCC CCCAGAACATATACAACCTTTACGAGCAAGTCAGCTACAACTGTTTCATCGCTGCAGGCC TTTACCTCCTCCTCGGAGGCTTCTCTTTCTGCCAAGTTCGGCTCAATAAGCGCAAGGAAT ACATGGTGCGCTAGGGCCCCGGCGCGTTTCCCCGCTCCAGCCCCTCCTCTATTTAAAGAC TCCCTGCACCGTGTCACCCAGGTCGCGTCCCACCCTTGCCGGCGCCCTCTGTGGGACTGG GTTTCCCGGGCGAGAGACTGAATCCCTTCTCCCATCTCTGGCATCCGGCCCCCGTGGAGA GGGCTGAGGCTGGGGGGGCTGTTCCGTCTCTCCACCCTTCGCTGTGTCCCGTATCTCAAT AAAGAGAATCTGCTCTCTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_001004333 |
| Insert Size | 650 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The insert of this clone has been fully sequenced and found to be a perfect match to NM_001004333.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001004333.1, NP_001004333.1 |
| RefSeq Size | 616 bp |
| RefSeq ORF | 297 bp |
| Locus ID | 440400 |
| UniProt ID | Q6P5S7 |
| Protein Families | Transmembrane |
| Gene Summary | Endoribonuclease which preferentially cleaves ApU and ApG phosphodiester bonds. Hydrolyzes UpU bonds at a lower rate.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the supported protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC208532 | RNASEK (Myc-DDK-tagged)-Human ribonuclease, RNase K (RNASEK), transcript variant 1 |
CNY 1,200.00 |
|
| RC208532L1 | Lenti ORF clone of Human ribonuclease, RNase K (RNASEK), transcript variant 1, Myc-DDK-tagged |
CNY 3,600.00 |
|
| RC208532L2 | Lenti ORF clone of Human ribonuclease, RNase K (RNASEK), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RC208532L3 | Lenti ORF clone of Human ribonuclease, RNase K (RNASEK), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC208532L4 | Lenti ORF clone of Human ribonuclease, RNase K (RNASEK), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG208532 | RNASEK (tGFP-tagged) - Human ribonuclease, RNase K (RNASEK), transcript variant 1 |
CNY 4,370.00 |
|
| SC322750 | RNASEK (untagged)-Human ribonuclease, RNase K (RNASEK), transcript variant 1 |
CNY 1,200.00 |
