United States
Germany
Japan
United Kingdom
China
SPFH2 (ERLIN2) (NM_001003791) Human Untagged Clone
CAT＃: SC300545
ERLIN2 (untagged)-Human ER lipid raft associated 2 (ERLIN2), transcript variant 3
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C8orf2; Erlin-2; NET32; SPFH2; SPG18 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001003791, the custom clone sequence may differ by one or more nucleotides
ATGGCTCAGTTGGGAGCAGTTGTGGCTGTGGCTTCCAGTTTCTTTTGTGCATCTCTCTTC TCAGCTGTGCACAAGATAGAAGAGGGACATATTGGGGTATATTACAGAGGCGGTGCCCTG CTGACTTCGACCAGCGGCCCTGGTTTCCATCTCATGCTCCCTTTCATCACATCATATAAG TCTGTGCAGACCACACTCCAGACAGATGAGGTGAAGAATGTACCTTGTGGGACTAGTGGT GGTGTGATGATCTACTTTGACAGAATTGAAGTGGTGAACTTCCTGGTCCCGAACGCAGTG TATGATATAGTGAAGAACTATACTGCTGACTATGACAAGGCCCTCATCTTCAACAAGATC CACCACGAACTGAACCAGTTCTGCAGTGTGCACACGCTTCAAGAGGTCTACATTGAGCTG TTTGGACTGGAAAATGATTTTTCCCAGGAATCTTCATAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001003791 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001003791.1, NP_001003791.1 |
| RefSeq Size | 1469 bp |
| RefSeq ORF | 459 bp |
| Locus ID | 11160 |
| UniProt ID | O94905 |
| Gene Summary | This gene encodes a member of the SPFH domain-containing family of lipid raft-associated proteins. The encoded protein is localized to lipid rafts of the endoplasmic reticulum and plays a critical role in inositol 1,4,5-trisphosphate (IP3) signaling by mediating ER-associated degradation of activated IP3 receptors. Mutations in this gene are a cause of spastic paraplegia-18 (SPG18). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012] Transcript Variant: This variant (3) differs in the 3' UTR and lacks a portion of the 3' coding region, compared to variant 1. Variants 2 and 3 encode the same isoform (2), which has a shorter and distinct C-terminus, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC223513 | ERLIN2 (Myc-DDK-tagged)-Human ER lipid raft associated 2 (ERLIN2), transcript variant 3 |
CNY 1,200.00 |
|
| RC223513L3 | Lenti-ORF clone of ERLIN2 (Myc-DDK-tagged)-Human ER lipid raft associated 2 (ERLIN2), transcript variant 3 |
CNY 5,890.00 |
|
| RC223513L4 | Lenti-ORF clone of ERLIN2 (mGFP-tagged)-Human ER lipid raft associated 2 (ERLIN2), transcript variant 3 |
CNY 5,890.00 |
|
| RG223513 | ERLIN2 (tGFP-tagged) - Human ER lipid raft associated 2 (ERLIN2), transcript variant 3 |
CNY 4,370.00 |
