LYK5 (STRADA) (NM_001003786) Human Untagged Clone
CAT#: SC300540
STRADA (untagged)-Human STE20-related kinase adaptor alpha (STRADA), transcript variant 2
CNY 6,370.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | LYK5; NY-BR-96; PMSE; Stlk; STRAD; STRAD alpha |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001003786, the custom clone sequence may differ by one or more nucleotides
ATGTCATTTCTTACCAATGATGCGAGCTCAGAGTCAATAGCATCCTTCTCTAAACAGGAG GTCATGAGTAGCTTTCTGCCAGAGGGAGGGTGTTACGAGCTGCTCACTGTGATAGGCAAA GGATTTGAGGACCTGATGACTGTGAATCTAGCAAGGTACAAACCAACAGGAGAGTACGTG ACTGTACGGAGGATTAACCTAGAAGCTTGTTCCAATGAGATGGTAACATTCTTGCAGGGC GAGCTGCATGTCTCCAAACTCTTCAACCATCCCAATATCGTGCCATATCGAGCCACTTTT ATTGCAGACAATGAGCTGTGGGTTGTCACATCATTCATGGCATACGGTTCTGCAAAAGAT CTCATCTGTACACACTTCATGGATGGCATGAATGAGCTGGCGATTGCTTACATCCTGCAG GGGGTGCTGAAGGCCCTCGACTACATCCACCACATGGGATATGTACACAGGAGTGTCAAA GCCAGCCACATCCTGATCTCTGTGGATGGGAAGGTCTACCTGTCTGGTTTGCGCAGCAAC CTCAGCATGATAAGCCATGGGCAGCGGCAGCGAGTGGTCCACGATTTTCCCAAGTACAGT GTCAAGGTTCTGCCGTGGCTCAGCCCCGAGGTCCTCCAGCAGAATCTCCAGGGTTATGAT GCCAAGTCTGACATCTACAGTGTGGGAATCACAGCCTGTGAACTGGCCAACGGCCATGTC CCCTTTAAGGATATGCCTGCCACCCAGATGCTGCTAGAGAAACTGAACGGCACAGTGCCC TGCCTGTTGGATACCAGCACCATCCCCGCTGAGGAGCTGACCATGAGCCCTTCGCGCTCA GTGGCCAACTCTGGCCTGAGTGACAGCCTGACCACCAGCACCCCCCGGCCCTCCAACGGT GACTCGCCCTCCCACCCCTACCACCGAACCTTCTCCCCCCACTTCCACCACTTTGTGGAG CAGTGCCTTCAGCGCAACCCGGATGCCAGGCCCAGTGCCAGCACCCTCCTGAACCACTCT TTCTTCAAGCAGATCAAGCGACGTGCCTCAGAGGCTTTGCCCGAATTGCTTCGTCCTGTC ACCCCCATCACCAATTTTGAGGGCAGCCAGTCTCAGGACCACAGTGGAATCTTTGGCCTG GTAACAAACCTGGAAGAGCTGGAGGTGGACGATTGGGAGTTCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001003786 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001003786.1, NP_001003786.1 |
RefSeq Size | 2112 bp |
RefSeq ORF | 1185 bp |
Locus ID | 92335 |
UniProt ID | Q7RTN6 |
Protein Families | Druggable Genome, Protein Kinase |
Protein Pathways | mTOR signaling pathway |
Gene Summary | The protein encoded by this gene contains a STE20-like kinase domain, but lacks several residues that are critical for catalytic activity, so it is termed a 'pseudokinase'. The protein forms a heterotrimeric complex with serine/threonine kinase 11 (STK11, also known as LKB1) and the scaffolding protein calcium binding protein 39 (CAB39, also known as MO25). The protein activates STK11 leading to the phosphorylation of both proteins and excluding STK11 from the nucleus. The protein is necessary for STK11-induced G1 cell cycle arrest. A mutation in this gene has been shown to result in polyhydramnios, megalencephaly, and symptomatic epilepsy (PMSE) syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described but their full-length nature is not known. [provided by RefSeq, Sep 2009] Transcript Variant: This variant (2) uses an alternate splice site and lacks two alternate exons in the 5' coding region, compared to variant 1. The resulting isoform (2) lacks an internal segment near the N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221633 | STRADA (Myc-DDK-tagged)-Human STE20-related kinase adaptor alpha (STRADA), transcript variant 2 |
CNY 3,656.00 |
|
RC221633L3 | Lenti-ORF clone of STRADA (Myc-DDK-tagged)-Human STE20-related kinase adaptor alpha (STRADA), transcript variant 2 |
CNY 5,890.00 |
|
RC221633L4 | Lenti-ORF clone of STRADA (mGFP-tagged)-Human STE20-related kinase adaptor alpha (STRADA), transcript variant 2 |
CNY 5,890.00 |
|
RG221633 | STRADA (tGFP-tagged) - Human STE20-related kinase adaptor alpha (STRADA), transcript variant 2 |
CNY 4,370.00 |