ATP5PF (NM_001003703) Human Untagged Clone
CAT#: SC300527
ATP5J (untagged)-Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6 (ATP5J), nuclear gene encoding mitochondrial protein, transcript variant 1
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ATP5; ATP5A; ATP5J; ATPM; CF6; F6 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC300527 representing NM_001003703.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGATTCTTCAGAGGCTCTTCAGGTTCTCCTCTGTCATTCGGTCAGCCGTCTCAGTCCATTTGCGGAGG AACATTGGTGTTACAGCAGTGGCATTTAATAAGGAACTTGATCCTATACAGAAACTCTTTGTGGACAAG ATTAGAGAATACAAATCTAAGCGACAGACATCTGGAGGACCTGTTGATGCTAGTTCAGAGTATCAGCAA GAGCTGGAGAGGGAGCTTTTTAAGCTCAAGCAAATGTTTGGTAATGCAGACATGAATACATTTCCCACC TTCAAATTTGAAGATCCCAAATTTGAAGTCATCGAAAAACCCCAGGCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001003703 |
Insert Size | 327 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001003703.1 |
RefSeq Size | 1303 bp |
RefSeq ORF | 327 bp |
Locus ID | 522 |
UniProt ID | P18859 |
Protein Pathways | Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
MW | 12.6 kDa |
Gene Summary | Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. It is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, which comprises the proton channel. The F1 complex consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled in a ratio of 3 alpha, 3 beta, and a single representative of the other 3. The Fo complex has nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the F6 subunit of the Fo complex. The F6 subunit is required for F1 and Fo interactions. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. This gene has 1 or more pseudogenes. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2, 3, 4, 6 and 7 encode the same isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221163 | ATP5J (Myc-DDK-tagged)-Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6 (ATP5J), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 1,200.00 |
|
RC221163L3 | Lenti ORF clone of Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6 (ATP5J), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC221163L4 | Lenti ORF clone of Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6 (ATP5J), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG221163 | ATP5J (tGFP-tagged) - Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6 (ATP5J), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 4,370.00 |