DERL3 (NM_001002862) Human Untagged Clone

CAT#: SC300468

DERL3 (untagged)-Human Der1-like domain family, member 3 (DERL3), transcript variant 2



  "NM_001002862" in other vectors (6)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-DERL3 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C22orf14; derlin-3; IZP6; LLN2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC300468 representing NM_001002862.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGTGGCAGGGACTAGCGGCCGAGTTCCTGCAGGTGCCGGCGGTGACGCGGGCTTACACCGCAGCC
TGTGTCCTCACCACCGCCGCGGTGCAGCTGGAGCTCCTCAGCCCCTTTCAACTCTACTTCAACCCGCAC
CTTGTGTTCCGGAAGTTCCAGGTCTGGAGGCTCGTCACCAACTTCCTCTTCTTCGGGCCCCTGGGATTC
AGCTTCTTCTTCAACATGCTCTTCGTGTTCCGCTACTGCCGCATGCTGGAAGAGGGCTCCTTCCGCGGC
CGCACGGCCGACTTCGTCTTCATGTTTCTCTTCGGGGGCGTCCTTATGACCCTGCTGGGACTCCTGGGC
AGCCTGTTCTTCCTGGGCCAGGCCCTCATGGCCATGCTGGTGTACGTGTGGAGCCGCCGCAGCCCTCGG
GTGAGGGTCAACTTCTTCGGCCTGCTCACTTTCCAGGCACCGTTCCTGCCTTGGGCGCTCATGGGCTTC
TCGCTGCTGCTGGGCAACTCCATCCTCGTGGACCTGCTGGGGATTGCGGTGGGCCATATCTACTACTTC
CTGGAGGACGTCTTCCCCAACCAGCCTGGAGGCAAGAGGCTCCTGCAGACCCCTGGCTTCCTAAAGCTG
CTCCTGGATGCCCCTGCAGAAGACCCCAATTACCTGCCCCTCCCTGAGGAACAGCCAGGACCCCATCTG
CCACCCCCGCAGCAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001002862
Insert Size 708 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001002862.2
RefSeq Size 3115 bp
RefSeq ORF 708 bp
Locus ID 91319
UniProt ID Q96Q80
Protein Families Transmembrane
MW 26.7 kDa
Gene Summary The protein encoded by this gene belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be involved in the degradation of misfolded glycoproteins in the ER. Several alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Oct 2008]
Transcript Variant: This variant (2) is alternatively spliced at the 3' end compared to transcript variant 1, resulting in a slightly shorter isoform (2) with a distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no quality transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...