EXOSC3 (NM_001002269) Human Untagged Clone

CAT#: SC300431

EXOSC3 (untagged)-Human exosome component 3 (EXOSC3), transcript variant 2



  "NM_001002269" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
EXOSC3 mouse monoclonal antibody, clone OTI1D6 (formerly 1D6)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms bA3J10.7; CGI-102; hRrp-40; p10; PCH1B; RRP40; Rrp40p
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC300431 representing NM_001002269.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCGAACCTGCGTCTGTCGCGGCTGAATCTCTCGCGGGCAGCAGGGCGCGCGCTGCACGCACAGTA
CTAGGTCAGGTGGTGCTCCCGGGTGAGGAGCTGCTCCTGCCGGAACAGGAGGACGCGGAAGGCCCTGGG
GGTGCAGTGGAGCGACCGTTGAGCCTGAATGCTAGAGCGTGCTCGCGGGTGCGCGTTGTATGCGGTCCG
GGCCTTCGGCGCTGTGGGGACCGCCTGCTGGTCACCAAGTGCGGCCGCCTCCGTCACAAGGAGCCCGGC
AGTGGCAGCGGCGGCGGTGTTTACTGGGTGGACTCTCAGCAGAAGCGGTATGTTCCAGTAAAAGGAGAC
CATGTGATTGGCATAGTGACAGCTAAATCTGGAGATATATTCAAAGTTGATGTTGGAGGGAGTGAGCCA
GCTTCTTTGTCTTACTTGTCATTTGAAGGTGCAACTAAAAGAAACAGACCAAATGTGCAGGCTATTAGC
TCCAGATTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001002269
Insert Size 495 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001002269.2
RefSeq Size 1705 bp
RefSeq ORF 495 bp
Locus ID 51010
UniProt ID Q9NQT5
Protein Families Stem cell - Pluripotency
Protein Pathways RNA degradation
MW 17.2 kDa
Gene Summary This gene encodes a non-catalytic component of the human exosome, a complex with 3'-5' exoribonuclease activity that plays a role in numerous RNA processing and degradation activities. Related pseudogenes of this gene are found on chromosome 19 and 21. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jun 2012]
Transcript Variant: This variant (2) lacks an exon in the coding region that causes a frameshift and leads to an early stop codon compared to variant 1. The resulting protein (isoform 2) is shorter and has a distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...