EXOSC3 (NM_001002269) Human Untagged Clone
CAT#: SC300431
EXOSC3 (untagged)-Human exosome component 3 (EXOSC3), transcript variant 2
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | bA3J10.7; CGI-102; hRrp-40; p10; PCH1B; RRP40; Rrp40p |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC300431 representing NM_001002269.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCGAACCTGCGTCTGTCGCGGCTGAATCTCTCGCGGGCAGCAGGGCGCGCGCTGCACGCACAGTA CTAGGTCAGGTGGTGCTCCCGGGTGAGGAGCTGCTCCTGCCGGAACAGGAGGACGCGGAAGGCCCTGGG GGTGCAGTGGAGCGACCGTTGAGCCTGAATGCTAGAGCGTGCTCGCGGGTGCGCGTTGTATGCGGTCCG GGCCTTCGGCGCTGTGGGGACCGCCTGCTGGTCACCAAGTGCGGCCGCCTCCGTCACAAGGAGCCCGGC AGTGGCAGCGGCGGCGGTGTTTACTGGGTGGACTCTCAGCAGAAGCGGTATGTTCCAGTAAAAGGAGAC CATGTGATTGGCATAGTGACAGCTAAATCTGGAGATATATTCAAAGTTGATGTTGGAGGGAGTGAGCCA GCTTCTTTGTCTTACTTGTCATTTGAAGGTGCAACTAAAAGAAACAGACCAAATGTGCAGGCTATTAGC TCCAGATTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001002269 |
Insert Size | 495 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001002269.2 |
RefSeq Size | 1705 bp |
RefSeq ORF | 495 bp |
Locus ID | 51010 |
UniProt ID | Q9NQT5 |
Protein Families | Stem cell - Pluripotency |
Protein Pathways | RNA degradation |
MW | 17.2 kDa |
Gene Summary | This gene encodes a non-catalytic component of the human exosome, a complex with 3'-5' exoribonuclease activity that plays a role in numerous RNA processing and degradation activities. Related pseudogenes of this gene are found on chromosome 19 and 21. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jun 2012] Transcript Variant: This variant (2) lacks an exon in the coding region that causes a frameshift and leads to an early stop codon compared to variant 1. The resulting protein (isoform 2) is shorter and has a distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218361 | EXOSC3 (Myc-DDK-tagged)-Human exosome component 3 (EXOSC3), transcript variant 2 |
CNY 1,200.00 |
|
RC218361L3 | Lenti ORF clone of Human exosome component 3 (EXOSC3), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC218361L4 | Lenti ORF clone of Human exosome component 3 (EXOSC3), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG218361 | EXOSC3 (tGFP-tagged) - Human exosome component 3 (EXOSC3), transcript variant 2 |
CNY 4,370.00 |