LCLAT1 (NM_001002257) Human Untagged Clone

CAT#: SC300422

LCLAT1 (untagged)-Human lysocardiolipin acyltransferase 1 (LCLAT1), transcript variant 2



  "NM_001002257" in other vectors (4)

CNY 7,220.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-LYCAT Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 1AGPAT8; AGPAT8; ALCAT1; HSRG1849; LYCAT; UNQ1849
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC300422 representing NM_001002257.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTGTCATGGAAAGGGATTTACTTTATACTGACTCTGTTTTGGGGAAGCTTTTTTGGAAGCATTTTC
ATGCTGAGTCCCTTTTTACCTTTGATGTTTGTAAACCCATCTTGGTATCGCTGGATCAACAACCGCCTT
GTGGCAACATGGCTCACCCTACCTGTGGCATTATTGGAGACCATGTTTGGTGTAAAAGTGATTATAACT
GGGGATGCATTTGTTCCTGGAGAAAGAAGTGTCATTATCATGAACCATCGGACAAGAATGGACTGGATG
TTCCTGTGGAATTGCCTGATGCGATATAGCTACCTCAGATTGGAGAAAATTTGCCTCAAAGCGAGTCTC
AAAGGTGTTCCTGGATTTGGTTGGGCCATGCAGGCTGCTGCCTATATCTTCATTCATAGGAAATGGAAG
GATGACAAGAGCCATTTCGAAGACATGATTGATTACTTTTGTGATATTCACGAACCACTTCAACTCCTC
ATATTCCCAGAAGGGACTGATCTCACAGAAAACAGCAAGTCTCGAAGTAATGCATTTGCTGAAAAAAAT
GGACTTCAGAAATATGAATATGTTTTACATCCAAGAACTACAGGCTTTACTTTTGTGGTAGACCGTCTA
AGAGAAGGTAAGAACCTTGATGCTGTCCATGATATCACTGTGGCGTATCCTCACAACATTCCTCAATCA
GAGAAGCACCTCCTCCAAGGAGACTTTCCCAGGGAAATCCACTTTCACGTCCACCGGTATCCAATAGAC
ACCCTCCCCACATCCAAGGAGGACCTTCAACTCTGGTGCCACAAACGGTGGGAAGAGAAAGAAGAGAGG
CTGCGTTCCTTCTATCAAGGGGAGAAGAATTTTTATTTTACCGGACAGAGTGTCATTCCACCTTGCAAG
TCTGAACTCAGGGTCCTTGTGGTCAAATTGCTCTCTATACTGTATTGGACCCTGTTCAGCCCTGCAATG
TGCCTACTCATATATTTGTACAGTCTTGTTAAGTGGTATTTTATAATCACCATTGTAATCTTTGTGCTG
CAAGAGAGAATATTTGGTGGACTGGAGATCATAGAACTTGCATGTTACCGACTTTTACACAAACAGCCA
CATTTAAATTCAAAGAAAAATGAGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001002257
Insert Size 1131 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001002257.2
RefSeq Size 4916 bp
RefSeq ORF 1131 bp
Locus ID 253558
UniProt ID Q6UWP7
Protein Families Transmembrane
Protein Pathways Ether lipid metabolism, Glycerolipid metabolism, Glycerophospholipid metabolism, Limonene and pinene degradation, Metabolic pathways, Phenylalanine metabolism, Tyrosine metabolism
MW 44.6 kDa
Gene Summary Exhibits acyl-CoA:lysocardiolipin acyltransferase (ALCAT) activity; catalyzes the reacylation of lyso-cardiolipin to cardiolipin (CL), a key step in CL remodeling (By similarity). Recognizes both monolysocardiolipin and dilysocardiolipin as substrates with a preference for linoleoyl-CoA and oleoyl-CoA as acyl donors (By similarity). Also exhibits 1-acyl-sn-glycerol-3-phosphate acyltransferase activity (AGPAT) activity; converts 1-acyl-sn-glycerol-3- phosphate (lysophosphatidic acid or LPA) into 1,2-diacyl-sn-glycerol-3- phosphate (phosphatidic acid or PA) by incorporating an acyl moiety at the sn-2 position of the glycerol backbone (PubMed:16620771). Possesses both lysophosphatidylinositol acyltransferase (LPIAT) and lysophosphatidylglycerol acyltransferase (LPGAT) activities (PubMed:19075029). Required for establishment of the hematopoietic and endothelial lineages (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' structure, and uses a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1. Variants 2 and 4 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...