United States
Germany
Japan
United Kingdom
China
Apc11 (ANAPC11) (NM_001002245) Human Untagged Clone
CAT＃: SC300412
ANAPC11 (untagged)-Human anaphase promoting complex subunit 11 (ANAPC11), transcript variant 3
CNY 1,800.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | APC11; Apc11p; HSPC214 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001002245, the custom clone sequence may differ by one or more nucleotides
ATGAAGGTGAAGATTAAGTGCTGGAACGGCGTGGCCACTTGGCTCTGGGTGGCCAACGATGAGAACTGTG GCATCTGCAGGATGGCATTTAACGGATGCTGCCCTGACTGCAAGGTGCCCGGCGACGACTGCCCGCTGGT GTGGGGCCAGTGCTCCCACTGCTTCCACATGCATTGCATCCTCAAGTGGCTGCACGCACAGCAGGTGCAG CAGCACTGCCCCATGTGCCGCCAGGAATGGAAGTTCAAGGAGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001002245 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001002245.1, NP_001002245.1 |
| RefSeq Size | 799 bp |
| RefSeq ORF | 255 bp |
| Locus ID | 51529 |
| UniProt ID | Q9NYG5 |
| Protein Families | Druggable Genome |
| Protein Pathways | Cell cycle, Oocyte meiosis, Progesterone-mediated oocyte maturation, Ubiquitin mediated proteolysis |
| Gene Summary | Together with the cullin protein ANAPC2, constitutes the catalytic component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. The APC/C complex acts by mediating ubiquitination and subsequent degradation of target proteins: it mainly mediates the formation of 'Lys-11'-linked polyubiquitin chains and, to a lower extent, the formation of 'Lys-48'- and 'Lys-63'-linked polyubiquitin chains. May recruit the E2 ubiquitin-conjugating enzymes to the complex.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) uses an alternate splice site in the 5' UTR and lacks an exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter than isoform 1. Variants 2, 3, 4, 5, 6, 7, 8, 9, 10, and 11 encode the isoform 2. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC223841 | ANAPC11 (Myc-DDK-tagged)-Human anaphase promoting complex subunit 11 (ANAPC11), transcript variant 3 |
CNY 1,800.00 |
|
| RC223841L3 | Lenti-ORF clone of ANAPC11 (Myc-DDK-tagged)-Human anaphase promoting complex subunit 11 (ANAPC11), transcript variant 3 |
CNY 5,890.00 |
|
| RC223841L4 | Lenti-ORF clone of ANAPC11 (mGFP-tagged)-Human anaphase promoting complex subunit 11 (ANAPC11), transcript variant 3 |
CNY 5,890.00 |
|
| RG223841 | ANAPC11 (tGFP-tagged) - Human anaphase promoting complex subunit 11 (ANAPC11), transcript variant 3 |
CNY 4,370.00 |
