LHX8 (NM_001001933) Human Untagged Clone

CAT#: SC300350

LHX8 (untagged)-Human LIM homeobox 8 (LHX8)



  "NM_001001933" in other vectors (6)

CNY 7,220.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-Lhx8 Antibody
    • 50 ug

CNY 4,628.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms LHX7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC300350 representing NM_001001933.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGATTCTGAGCAGGTGTCAGGGGCTCATGTCAGAGGAGTGCGGGCGGACTACAGCCCTGGCGGCC
GGGAGGACTCGCAAAGGCGCCGGGGAAGAGGGACTGGTGAGCCCCGAGGGAGCGGGGGACGAGGACTCG
TGCTCCTCCTCGGCCCCGCTGTCCCCGTCGTCCTCGCCCCGGTCCATGGCCTCGGGCTCCGGCTGCCCT
CCTGGCAAGTGTGTGTGCAACAGTTGCGGCCTGGAGATCGTGGACAAATACCTTCTCAAGGTGAATGAC
CTATGCTGGCATGTCCGGTGTCTCTCCTGCAGTGTTTGCAGAACCTCCCTAGGAAGGCACACCAGCTGT
TATATTAAAGACAAAGACATTTTCTGCAAACTTGATTATTTCAGAAGGTATGGAACTCGCTGCTCTCGA
TGTGGGAGACACATCCATTCTACTGACTGGGTCCGGAGAGCCAAGGGGAATGTCTATCACTTGGCATGC
TTTGCCTGCTTTTCCTGCAAAAGGCAACTTTCCACAGGAGAGGAGTTTGCTTTGGTGGAAGAGAAAGTC
CTCTGCAGAGTACATTATGACTGCATGCTGGATAATTTAAAAAGAGAAGTAGAAAATGGGAATGGGATT
AGTGTGGAAGGTGCCCTCCTCACAGAGCAAGATGTTAACCATCCAAAACCAGCAAAAAGAGCTCGGACC
AGCTTTACAGCAGATCAGCTTCAGGTTATGCAAGCACAATTTGCTCAGGACAACAACCCAGATGCACAG
ACACTCCAGAAATTGGCAGAAAGGACAGGCTTGAGCAGACGTGTGATACAGGTGTGGTTTCAGAATTGT
AGAGCACGCCACAAGAAACACGTCAGTCCTAATCACTCATCCTCCACCCCAGTCACAGCAGTCCCACCC
TCCAGGCTGTCTCCACCCATGTTAGAAGAAATGGCTTATTCTGCCTACGTGCCCCAAGATGGAACGATG
TTAACTGCGCTGCATAGTTATATGGATGCTCATTCACCAACAACTCTTGGACTCCAGCCCTTGTTACCC
CATTCAATGACACAACTGCCAATAAGTCATACCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001001933
Insert Size 1071 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001001933.1
RefSeq Size 2393 bp
RefSeq ORF 1071 bp
Locus ID 431707
UniProt ID Q68G74
MW 39.3 kDa
Gene Summary The protein encoded by this gene is a member of the LIM homeobox family of proteins, which are involved in patterning and differentiation of various tissue types. These proteins contain two tandemly repeated cysteine-rich double-zinc finger motifs known as LIM domains, in addition to a DNA-binding homeodomain. This family member is a transcription factor that plays a role in tooth morphogenesis. It is also involved in oogenesis and in neuronal differentiation. This gene is a candidate gene for cleft palate, and it is also associated with odontoma formation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...