United States
Germany
Japan
United Kingdom
China
IKB beta (NFKBIB) (NM_001001716) Human Untagged Clone
CAT＃: SC300298
NFKBIB (untagged)-Human nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta (NFKBIB), transcript variant 2
CNY 6,270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | IKBB; TRIP9 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC300298 representing NM_001001716.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAATGGTGCGACAGCGGCCTGGGCTCCCTGGGTCCGGACGCAGCGGCCCCCGGAGGACCTGGGTTGG GCGCGGAGTTGGGCCCGGGGCTGTCGTGGGCTCCCCTCGTCTTCGGCTACGTCACTGAGGATGGGGACA CGCTTCTCGGCCGGCACTGAGTACATGGACCTGCAGAATGACCTAGGCCAGACAGCCCTGCACCTGGCA GCCATCCTGGGGGAGACATCCACGGTGGAGAAGCTGTACGCAGCAGGCGCCGGGCTGTGTGTGGCGGAG CGTAGGGGCCACACGGCGCTGCACCTGGCCTGCCGTGTGGGGGCACACGCCTGTGCCCGTGCCCTGCTT CAGCCCCGCCCCCGGCGCCCCAGGGAAGCCCCCGACACCTACCTCGCTCAGGGCCCTGACCGTACTCCC GACACCAACCATACCCCTGTCGCCTTGTACCCCGATTCCGACTTGGAGAAGGAAGAAGAGGAGAGTGAG GAGGACTGGAAGCTGCAGCTGGAGGCTGAAAACTACGAGGGCCACACCCCACTCCACGTGGCCGTTATC CACAAAGATGTGGAGATGGTCCGGCTGCTCCGAGATGCTGGAGCTGACCTTGACAAACCGGAGCCCACG TGCGGCCGGAGCCCCCTTCATTTGGCAGTGGAGGCCCAGGCAGCCGATGTGCTGGAGCTTCTCCTGAGG GCAGGCGCGAACCCTGCTGCCCGCATGTACGGTGGCCGCACCCCACTCGGCAGTGCCATGCTCCGGCCC AACCCCATCCTCGCCCGCCTCCTCCGTGCACACGGAGCCCCTGAGCCCGAGGGCGAGGACGAGAAATCC GGCCCCTGCAGCAGCAGTAGCGACAGCGACAGCGGAGACGAGGGCGTGAGTCAGGAGGAGAGACAGGGC AGCCCAGCTGGGGGGTCAGGATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001001716 |
| Insert Size | 921 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001001716.1 |
| RefSeq Size | 2213 bp |
| RefSeq ORF | 921 bp |
| Locus ID | 4793 |
| Protein Families | Stem cell - Pluripotency, Transcription Factors |
| Protein Pathways | Adipocytokine signaling pathway, B cell receptor signaling pathway, Chemokine signaling pathway, Cytosolic DNA-sensing pathway, Neurotrophin signaling pathway, NOD-like receptor signaling pathway, RIG-I-like receptor signaling pathway, T cell receptor signaling pathway |
| MW | 32.8 kDa |
| Gene Summary | The protein encoded by this gene belongs to the NF-kappa-B inhibitor family, which inhibit NF-kappa-B by complexing with, and trapping it in the cytoplasm. Phosphorylation of serine residues on these proteins by kinases marks them for destruction via the ubiquitination pathway, thereby allowing activation of the NF-kappa-B, which translocates to the nucleus to function as a transcription factor. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jul 2011] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218695 | NFKBIB (Myc-DDK-tagged)-Human nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta (NFKBIB), transcript variant 2 |
CNY 3,600.00 |
|
| RC218695L3 | Lenti ORF clone of Human nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta (NFKBIB), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC218695L4 | Lenti ORF clone of Human nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta (NFKBIB), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG218695 | NFKBIB (tGFP-tagged) - Human nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta (NFKBIB), transcript variant 2 |
CNY 4,370.00 |
其它IKB beta产品
