UBE2W (NM_001001481) Human Untagged Clone

CAT#: SC300195

UBE2W (untagged)-Human ubiquitin-conjugating enzyme E2W (putative) (UBE2W), transcript variant 1



  "NM_001001481" in other vectors (6)

CN¥ 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00


UBE2W rabbit polyclonal antibody
    • 100 ul

CN¥ 1,999.00
CN¥ 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms UBC-16; UBC16
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001001481, the custom clone sequence may differ by one or more nucleotides
ATGGCGTCAATGCAGACCACAGGAAGGAGGGTGGAAGTATGGTTTCCAAAACGACTACAG
AAAGAACTGTTGGCTTTGCAAAATGACCCACCTCCTGGAATGACCTTAAATGAGAAGAGT
GTTCAAAATTCAATTACACAGTGGATTGTAGACATGGAAGGTGCACCAGGTACCTTATAT
GAAGGGGAAAAATTTCAACTTCTATTTAAATTTAGTAGTCGATATCCTTTTGACTCTCCT
CAGGTCATGTTTACTGGTGAAAATATTCCTGTTCATCCTCATGTTTATAGCAATGGTCAT
ATCTGTTTATCCATTCTAACAGAAGACTGGTCCCCAGCGCTCTCAGTCCAATCAGTTTGT
CTTAGCATTATTAGCATGCTTTCCAGCTGCAAGGAAAAGAGACGACCACCGGATAATTCT
TTTTATGTGCGAACATGTAACAAGAATCCAAAGAAAACAAAATGGTGGTATCATGATGAT
ACTTGTTGA
Restriction Sites Please inquire     
ACCN NM_001001481
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001001481.1, NP_001001481.1
RefSeq Size 4057 bp
RefSeq ORF 489 bp
Locus ID 55284
UniProt ID Q96B02
Protein Families Transcription Factors
Protein Pathways Ubiquitin mediated proteolysis
Gene Summary This gene encodes a nuclear-localized ubiquitin-conjugating enzyme (E2) that, along with ubiquitin-activating (E1) and ligating (E3) enzymes, coordinates the addition of a ubiquitin moiety to existing proteins. The encoded protein promotes the ubiquitination of Fanconi anemia complementation group proteins and may be important in the repair of DNA damage. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: The coding region has been updated to shorten the N-terminus to one that is more supported by conservation.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...