United States
Germany
Japan
United Kingdom
China
GnRH (GNRH1) (NM_000825) Human Untagged Clone
CAT＃: SC300137
GNRH1 (untagged)-Human gonadotropin-releasing hormone 1 (luteinizing-releasing hormone) (GNRH1), transcript variant 1
CNY 1,800.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | GNRH; GRH; LHRH; LNRH |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_000825 edited
CCCACAGATGGTTCAGCCAGCAGTAATGCTAGGAAGACTGAAGGATAAATAGAAAAATGT CATTAGTACCATGGGGTAGCCATGTAATGTCAAGCAATTTTATATTAGCCAGAGATTCCT AGTAGGAGCTACTTTTCTTAACAGATGACTCAGTTCTCTTTATCTCAGGAATGAAAGAGT TGAAGACCAATCCACAACAGGGGAAATGTTAAGGCAAAATGATGAACTTGATAAGGGATG AATTATGGGGTTTGGATAACCAAACAATAAAAATAAAAGTATAGACTATTTTAGTACTAA AAAGGTCCTGAACATGTGAGCTTAAGTACTCATTTTGTCCCCAGTGGCTAAGAAACTAAA GGCAAGCCAGCAAGTGTCTCTGAGTTTCAGTGTCTGTATGTAAAAACTGACTCTGACTTC CATCTTCTGCAGGGTTAGTGATACAGATGCTAGCTTTTTCACTAAAGAGGTCTTTTAGTT TATACTCAACCTTGTCTGGATCTAATTTGATTGTGCATTCATGTGCCTTAGAATGAAGCC AATTCAAAAACTCCTAGCTGGCCTTATTCTACTGACTTGGTGCGTGGAAGGCTGCTCCAG CCAGCACTGGTCCTATGGACTGCGCCCTGGAGGAAAGAGAGATGCCGAAAATTTGATTGA TTCTTTCCAAGAGATAGTCAAAGAGGTTGGTCAACTGGCAGAAACCCAACGCTTCGAATG CACCACGCACCAGCCACGTTCTCCCCTCCGAGACCTGAAAGGAGCTCTGGAAAGTCTGAT TGAAGAGGAAACTGGGCAGAAGAAGATTTAAATCCATTGGGCCAGAAGGAATGACCAT |
| Restriction Sites | Please inquire |
| ACCN | NM_000825 |
| Insert Size | 800 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000825.2. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_000825.2, NP_000816.2 |
| RefSeq Size | 1512 bp |
| RefSeq ORF | 279 bp |
| Locus ID | 2796 |
| Protein Families | Druggable Genome, Secreted Protein |
| Protein Pathways | GnRH signaling pathway |
| Gene Summary | This gene encodes a preproprotein that is proteolytically processed to generate a peptide that is a member of the gonadotropin-releasing hormone (GnRH) family of peptides. Alternative splicing results in multiple transcript variants, at least one of which is secreted and then cleaved to generate gonadoliberin-1 and GnRH-associated peptide 1. Gonadoliberin-1 stimulates the release of luteinizing and follicle stimulating hormones, which are important for reproduction. Mutations in this gene are associated with hypogonadotropic hypogonadism. [provided by RefSeq, Nov 2015] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). This isoform (1) may undergo proteolytic processing similar to isoform (2). |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Isolated Familial Hypogonadotropic Hypogonadism and a GNRH1 Mutation
,Jérôme Bouligand, Cristina Ghervan, Javier A. Tello, Sylvie Brailly-Tabard, Sylvie Salenave, Philippe Chanson, Marc Lombès, Robert P. Millar, Anne Guiochon-Mantel, and Jacques Young,
N. Engl. J. Med., Jun 2009; 360: 2742 - 2748.
[GNRH1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC212991 | GNRH1 (Myc-DDK-tagged)-Human gonadotropin-releasing hormone 1 (luteinizing-releasing hormone) (GNRH1), transcript variant 1 |
CNY 1,800.00 |
|
| RC212991L3 | Lenti ORF clone of Human gonadotropin-releasing hormone 1 (luteinizing-releasing hormone) (GNRH1), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC212991L4 | Lenti ORF clone of Human gonadotropin-releasing hormone 1 (luteinizing-releasing hormone) (GNRH1), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG212991 | GNRH1 (tGFP-tagged) - Human gonadotropin-releasing hormone 1 (luteinizing-releasing hormone) (GNRH1), transcript variant 1 |
CNY 3,400.00 |
