Folate Binding Protein (FOLR1) (NM_000802) Human Untagged Clone

CAT#: SC300134

FOLR1 (untagged)-Human folate receptor 1 (adult) (FOLR1), transcript variant 2



  "NM_000802" in other vectors (6)

CNY 3,600.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
FOLR1 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 4,090.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FBP; FOLR; FRalpha; NCFTD
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC300134 representing NM_000802.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTCAGCGGATGACAACACAGCTGCTGCTCCTTCTAGTGTGGGTGGCTGTAGTAGGGGAGGCTCAG
ACAAGGATTGCATGGGCCAGGACTGAGCTTCTCAATGTCTGCATGAACGCCAAGCACCACAAGGAAAAG
CCAGGCCCCGAGGACAAGTTGCATGAGCAGTGTCGACCCTGGAGGAAGAATGCCTGCTGTTCTACCAAC
ACCAGCCAGGAAGCCCATAAGGATGTTTCCTACCTATATAGATTCAACTGGAACCACTGTGGAGAGATG
GCACCTGCCTGCAAACGGCATTTCATCCAGGACACCTGCCTCTACGAGTGCTCCCCCAACTTGGGGCCC
TGGATCCAGCAGGTGGATCAGAGCTGGCGCAAAGAGCGGGTACTGAACGTGCCCCTGTGCAAAGAGGAC
TGTGAGCAATGGTGGGAAGATTGTCGCACCTCCTACACCTGCAAGAGCAACTGGCACAAGGGCTGGAAC
TGGACTTCAGGGTTTAACAAGTGCGCAGTGGGAGCTGCCTGCCAACCTTTCCATTTCTACTTCCCCACA
CCCACTGTTCTGTGCAATGAAATCTGGACTCACTCCTACAAGGTCAGCAACTACAGCCGAGGGAGTGGC
CGCTGCATCCAGATGTGGTTCGACCCAGCCCAGGGCAACCCCAATGAGGAGGTGGCGAGGTTCTATGCT
GCAGCCATGAGTGGGGCTGGGCCCTGGGCAGCCTGGCCTTTCCTGCTTAGCCTGGCCCTAATGCTGCTG
TGGCTGCTCAGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_000802
Insert Size 774 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_000802.3
RefSeq Size 962 bp
RefSeq ORF 774 bp
Locus ID 2348
UniProt ID P15328
Protein Families Druggable Genome, Secreted Protein, Transmembrane
MW 29.8 kDa
Gene Summary The protein encoded by this gene is a member of the folate receptor family. Members of this gene family bind folic acid and its reduced derivatives, and transport 5-methyltetrahydrofolate into cells. This gene product is a secreted protein that either anchors to membranes via a glycosyl-phosphatidylinositol linkage or exists in a soluble form. Mutations in this gene have been associated with neurodegeneration due to cerebral folate transport deficiency. Due to the presence of two promoters, multiple transcription start sites, and alternative splicing, multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Oct 2009]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 7. Variants 1, 2, 4 and 7 all encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...