IL9 (NM_000590) Human Untagged Clone
CAT#: SC300105
IL9 (untagged)-Human interleukin 9 (IL9)
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HP40; IL-9; P40 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_000590 edited
CCGCTGTCAAGATGCTTCTGGCCATGGTCCTTACCTCTGCCCTGCTCCTGTGCTCCGTGG CAGGCCAGGGGTGTCCAACCTTGGCGGGGATCCTGGACATCAACTTCCTCATCAACAAGA TGCAGGAAGATCCAGCTTCCAAGTGCCACTGCAGTGCTAATGTGACCAGTTGTCTCTGTT TGGGCATTCCCTCTGACAACTGCACCAGACCATGCTTCAGTGAGAGACTGTCTCAGATGA CCAATACCACCATGCAAACAAGATACCCACTGATTTTCAGTCGGGTGAAAAAATCAGTTG AAGTACTAAAGAACAACAAGTGTCCATATTTTTCCTGTGAACAGCCATGCAACCAAACCA CGGCAGGCAACGCGCTGACATTTCTGAAGAGTCTTCTGGAAATTTTCCAGAAAGAAAAGA TGAGAGGGATGAGAGGCAAGATATGAAGATGAAA |
Restriction Sites | Please inquire |
ACCN | NM_000590 |
Insert Size | 500 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000590.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_000590.1, NP_000581.1 |
RefSeq Size | 591 bp |
RefSeq ORF | 435 bp |
Locus ID | 3578 |
UniProt ID | P15248 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Asthma, Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway |
Gene Summary | The protein encoded by this gene is a cytokine that acts as a regulator of a variety of hematopoietic cells. This cytokine stimulates cell proliferation and prevents apoptosis. It functions through the interleukin 9 receptor (IL9R), which activates different signal transducer and activator (STAT) proteins and thus connects this cytokine to various biological processes. The gene encoding this cytokine has been identified as a candidate gene for asthma. Genetic studies on a mouse model of asthma demonstrated that this cytokine is a determining factor in the pathogenesis of bronchial hyperresponsiveness. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC209682 | IL9 (Myc-DDK-tagged)-Human interleukin 9 (IL9) |
CNY 1,200.00 |
|
RC209682L3 | Lenti ORF clone of Human interleukin 9 (IL9), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC209682L4 | Lenti ORF clone of Human interleukin 9 (IL9), mGFP tagged |
CNY 5,890.00 |
|
RG209682 | IL9 (tGFP-tagged) - Human interleukin 9 (IL9) |
CNY 2,800.00 |