TSH beta (TSHB) (NM_000549) Human Untagged Clone
CAT#: SC300095
TSHB (untagged)-Human thyroid stimulating hormone, beta (TSHB)
CN¥ 1,200.00
CN¥ 3,990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | TSH-B; TSH-BETA |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_000549 edited
ATGACTGCTCTCTTTCTGATGTCCATGCTTTTTGGCCTTGCATGTGGGCAAGCGATGTCT TTTTGTATTCCAACTGAGTATACAATGCACATCGAAAGGAGAGAGTGTGCTTATTGCCTA ACCATCAACACCACCATCTGTGCTGGATATTGTATGACACGGGATATCAATGGCAAACTG TTTCTTCCCAAATATGCTCTGTCCCAGGATGTTTGCACATATAGAGACTTCATCTACAGG ACTGTAGAAATACCAGGATGCCCACTCCATGTTGCTCCCTATTTTTCCTATCCTGTTGCT TTAAGCTGTAAGTGTGGCAAGTGCAATACTGACTATAGTGACTGCATACATGAAGCCATC AAGACAAACTACTGTACCAAACCTCAGAAGTCTTATCTGGTAGGATTTTCTGTCTAA |
Restriction Sites | Please inquire |
ACCN | NM_000549 |
Insert Size | 500 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000549.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_000549.2, NP_000540.1 |
RefSeq Size | 578 bp |
RefSeq ORF | 417 bp |
Locus ID | 7252 |
UniProt ID | P01222 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Autoimmune thyroid disease, Neuroactive ligand-receptor interaction |
Gene Summary | The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. Thyroid stimulating hormone functions in the control of thyroid structure and metabolism. The protein encoded by this gene is the beta subunit of thyroid stimulating hormone. Mutations in this gene are associated with congenital central and secondary hypothyroidism and Hashimoto's thyroiditis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1, also known as native TSH-beta). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments and data in published reports (PMID 3243440). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216914 | TSHB (Myc-DDK-tagged)-Human thyroid stimulating hormone, beta (TSHB) |
CN¥ 1,200.00 |
|
RC216914L1 | Lenti ORF clone of Human thyroid stimulating hormone, beta (TSHB), Myc-DDK-tagged |
CN¥ 3,600.00 |
|
RC216914L2 | Lenti ORF clone of Human thyroid stimulating hormone, beta (TSHB), mGFP tagged |
CN¥ 5,890.00 |
|
RC216914L3 | Lenti ORF clone of Human thyroid stimulating hormone, beta (TSHB), Myc-DDK-tagged |
CN¥ 5,890.00 |
|
RC216914L4 | Lenti ORF clone of Human thyroid stimulating hormone, beta (TSHB), mGFP tagged |
CN¥ 5,890.00 |
|
RG216914 | TSHB (tGFP-tagged) - Human thyroid stimulating hormone, beta (TSHB) |
CN¥ 4,370.00 |
其它TSH beta产品