United States
Germany
Japan
United Kingdom
China
MS4A2 (NM_000139) Human Untagged Clone
CAT＃: SC300015
MS4A2 (untagged)-Human membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor for, beta polypeptide) (MS4A2)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | APY; ATOPY; FCER1B; FCERI; IGEL; IGER; IGHER; MS4A1 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_000139 edited
CATGCAGTAAGAGGAAATCCACCAAGTCTCAATATAATAATATTCTTTATTCCTGGACAG CTCGGTTAATGAAAAAATGGACACAGAAAGTAATAGGAGAGCAAATCTTGCTCTCCCACA GGAGCCTTCCAGTGTGCCTGCATTTGAAGTCTTGGAAATATCTCCCCAGGAAGTATCTTC AGGCAGACTATTGAAGTCGGCCTCATCCCCACCACTGCATACATGGCTGACAGTTTTGAA AAAAGAGCAGGAGTTCCTGGGGGTAACACAAATTCTGACTGCTATGATATGCCTTTGTTT TGGAACAGTTGTCTGCTCTGTACTTGATATTTCACACATTGAGGGAGACATTTTTTCATC ATTTAAAGCAGGTTATCCATTCTGGGGAGCCATATTTTTTTCTATTTCTGGAATGTTGTC AATTATATCTGAAAGGAGAAATGCAACATATCTGGTGAGAGGAAGCCTGGGAGCAAACAC TGCCAGCAGCATAGCTGGGGGAACGGGAATTACCATCCTGATCATCAACCTGAAGAAGAG CTTGGCCTATATCCACATCCACAGTTGCCAGAAATTTTTTGAGACCAAGTGCTTTATGGC TTCCTTTTCCACTGAAATTGTAGTGATGATGCTGTTTCTCACCATTCTGGGACTTGGTAG TGCTGTGTCACTCACAATCTGTGGAGCTGGGGAAGAACTCAAAGGAAACAAGGTTCCAGA GGATCGTGTTTATGAAGAATTAAACATATATTCAGCTACTTACAGTGAGTTGGAAGACCC AGGGGAAATGTCTCCTCCCATTGATTTATAAGAATCACGTGTCCAGAACACTCTGATTCA CAGCCAAGGATCCAGAAGGCCAAGGTCTTGTTAAGGGGCTACTGGAAAAATTTCTATTCT CTCCACAGCCTGCTGGTT |
| Restriction Sites | Please inquire |
| ACCN | NM_000139 |
| Insert Size | 900 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_000139.2, NP_000130.1 |
| RefSeq Size | 3723 bp |
| RefSeq ORF | 735 bp |
| Locus ID | 2206 |
| UniProt ID | Q01362 |
| Protein Families | Druggable Genome, Transmembrane |
| Protein Pathways | Asthma, Fc epsilon RI signaling pathway |
| Gene Summary | The allergic response involves the binding of allergen to receptor-bound IgE followed by cell activation and the release of mediators responsible for the manifestations of allergy. The IgE-receptor, a tetramer composed of an alpha, beta, and 2 disulfide-linked gamma chains, is found on the surface of mast cells and basophils. This gene encodes the beta subunit of the high affinity IgE receptor which is a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. This family member is localized to 11q12, among a cluster of membrane-spanning 4A gene family members. Alternative splicing results in multiple transcript variants encoding distinct proteins. Additional transcript variants have been described but require experimental validation. [provided by RefSeq, Mar 2012] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1) that traffics to the cytoplasmic membrane. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC210371 | MS4A2 (Myc-DDK-tagged)-Human membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor for, beta polypeptide) (MS4A2) |
CNY 2,400.00 |
|
| RC210371L1 | Lenti ORF clone of Human membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor for; beta polypeptide) (MS4A2), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC210371L2 | Lenti ORF clone of Human membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor for; beta polypeptide) (MS4A2), mGFP tagged |
CNY 5,890.00 |
|
| RC210371L3 | Lenti ORF clone of Human membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor for; beta polypeptide) (MS4A2), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC210371L4 | Lenti ORF clone of Human membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor for; beta polypeptide) (MS4A2), mGFP tagged |
CNY 5,890.00 |
|
| RG210371 | MS4A2 (tGFP-tagged) - Human membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor for; beta polypeptide) (MS4A2) |
CNY 4,000.00 |
