United States
Germany
Japan
United Kingdom
China
Dysadherin (FXYD5) (NM_144779) Human Untagged Clone
CAT＃: SC127643
FXYD5 (untagged)-Human FXYD domain containing ion transport regulator 5 (FXYD5), transcript variant 1
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DYSAD; HSPC113; IWU1; KCT1; OIT2; PRO6241; RIC |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC127643 representing NM_144779.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCGCCCTCTGGTCGCCTGTGTCTTCTCACCATCGTTGGCCTGATTCTCCCCACCAGAGGACAGACG TTGAAAGATACCACGTCCAGTTCTTCAGCAGACTCAACTATCATGGACATTCAGGTCCCGACACGAGCC CCAGATGCAGTCTACACAGAACTCCAGCCCACCTCTCCAACCCCAACCTGGCCTGCTGATGAAACACCA CAACCCCAGACCCAGACCCAGCAACTGGAAGGAACGGATGGGCCTCTAGTGACAGATCCAGAGACACAC AAGAGCACCAAAGCAGCTCATCCCACTGATGACACCACGACGCTCTCTGAGAGACCATCCCCAAGCACA GACGTCCAGACAGACCCCCAGACCCTCAAGCCATCTGGTTTTCATGAGGATGACCCCTTCTTCTATGAT GAACACACCCTCCGGAAACGGGGGCTGTTGGTCGCAGCTGTGCTGTTCATCACAGGCATCATCATCCTC ACCAGTGGCAAGTGCAGGCAGCTGTCCCGGTTATGCCGGAATCGTTGCAGGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Chromatograms |
CHROMATOGRAMS
 Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_144779 |
| Insert Size | 537 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_144779.1 |
| RefSeq Size | 927 bp |
| RefSeq ORF | 537 bp |
| Locus ID | 53827 |
| UniProt ID | Q96DB9 |
| Protein Families | Druggable Genome, Ion Channels: Other, Transmembrane |
| MW | 19.5 kDa |
| Gene Summary | This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. Mouse FXYD5 has been termed RIC (Related to Ion Channel). FXYD2, also known as the gamma subunit of the Na,K-ATPase, regulates the properties of that enzyme. FXYD1 (phospholemman), FXYD2 (gamma), FXYD3 (MAT-8), FXYD4 (CHIF), and FXYD5 (RIC) have been shown to induce channel activity in experimental expression systems. Transmembrane topology has been established for two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. This gene product, FXYD5, is a glycoprotein that functions in the up-regulation of chemokine production, and it is involved in the reduction of cell adhesion via its ability to down-regulate E-cadherin. It also promotes metastasis, and has been linked to a variety of cancers. Alternative splicing results in multiple transcript variants. [RefSeq curation by Kathleen J. Sweadner, Ph.D., sweadner@helix.mgh.harvard.edu., Sep 2009] Transcript Variant: This variant (1) encodes the same protein as variants 2 and 3. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC203917 | FXYD5 (Myc-DDK-tagged)-Human FXYD domain containing ion transport regulator 5 (FXYD5), transcript variant 1 |
CNY 2,400.00 |
|
| RC203917L3 | Lenti-ORF clone of FXYD5 (Myc-DDK-tagged)-Human FXYD domain containing ion transport regulator 5 (FXYD5), transcript variant 1 |
CNY 5,890.00 |
|
| RC203917L4 | Lenti-ORF clone of FXYD5 (mGFP-tagged)-Human FXYD domain containing ion transport regulator 5 (FXYD5), transcript variant 1 |
CNY 5,890.00 |
|
| RG203917 | FXYD5 (tGFP-tagged) - Human FXYD domain containing ion transport regulator 5 (FXYD5), transcript variant 1 |
CNY 4,000.00 |
其它Dysadherin产品
