United States
Germany
Japan
United Kingdom
China
OAZ2 (NM_002537) Human Untagged Clone
CAT＃: SC127406
OAZ2 (untagged)-Human ornithine decarboxylase antizyme 2 (OAZ2)
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AZ2 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_002537 edited
ATGATAAACACCCAGGACAGTAGTATTTTGCCTTTGAGTAACTGTCCCCAGCTCCAGTGC TGCAGGCACATTGTTCCAGGGCCTCTGTGGTGCTCCGATGCCCCTCACCCACTGTCGAAG ATCCCCGGTGGGCGAGGGGGCGGCAGGGATCCTTCTCTCTCAGCTCTAATATATAAGGAC GAGAAGCTCACTGTGACCCAGGACCTCCCTGTGAATGATGGAAAACCTCACATCGTCCAC TTCCAGTATGAGGTCACCGAGGTGAAGGTCTCTTCTTGGGATGCAGTCCTGTCCAGCCAG AGCCTGTTTGTAGAAATCCCAGATGGATTATTAGCTGATGGGAGCAAAGAAGGATTGTTA GCACTGCTAGAGTTTGCTGAAGAGAAGATGAAAGTGAACTATGTCTTCATCTGCTTCAGG AAGGGCCGAGAAGACAGAGCTCCACTCCTGAAGACCTTCAGCTTCTTGGGCTTTGAGATT GTACGTCCAGGCCATCCCTGTGTCCCCTCTCGGCCAGATGTGATGTTCATGGTTTATCCC CTGGACCAGAACTTGTCCGATGAGGACTAA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_002537 |
| Insert Size | 1950 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_002537.1, NP_002528.1 |
| RefSeq Size | 1906 bp |
| RefSeq ORF | 192 bp |
| Locus ID | 4947 |
| UniProt ID | O95190 |
| Gene Summary | The protein encoded by this gene belongs to the ornithine decarboxylase antizyme family, which plays a role in cell growth and proliferation by regulating intracellular polyamines. Expression of antizymes requires +1 ribosomal frameshifting, which is enhanced by high levels of polyamines. Antizymes in turn bind to and inhibit ornithine decarboxylase (ODC), the key enzyme in polyamine biosynthesis; thus, completing the auto-regulatory circuit. This gene encodes antizyme 2, the second member of the antizyme family. Like antizyme 1, antizyme 2 has broad tissue distribution, inhibits ODC activity and polyamine uptake, and stimulates ODC degradation in vivo; however, it fails to promote ODC degradation in vitro. Antizyme 2 is expressed at lower levels than antizyme 1, but is evolutionary more conserved, suggesting it likely has an important biological role. Studies also show different subcellular localization of antizymes 1 and 2, indicating specific function for each antizyme in discrete compartments of the cell. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2014] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC215120 | OAZ2 (Myc-DDK-tagged)-Human ornithine decarboxylase antizyme 2 (OAZ2) |
CNY 1,200.00 |
|
| RC215120L3 | Lenti-ORF clone of OAZ2 (Myc-DDK-tagged)-Human ornithine decarboxylase antizyme 2 (OAZ2) |
CNY 5,890.00 |
|
| RC215120L4 | Lenti-ORF clone of OAZ2 (mGFP-tagged)-Human ornithine decarboxylase antizyme 2 (OAZ2) |
CNY 5,890.00 |
|
| RG215120 | OAZ2 (tGFP-tagged) - Human ornithine decarboxylase antizyme 2 (OAZ2) |
CNY 4,370.00 |
