Ribosomal Protein S29 (RPS29) (NM_001032) Human Untagged Clone

CAT#: SC126912

RPS29 (untagged)-Human ribosomal protein S29 (RPS29), transcript variant 1



  "NM_001032" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-RPS29 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DBA13; S29; uS14
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001032, the custom clone sequence may differ by one or more nucleotides


ATGGGTCACCAGCAGCTGTACTGGAGCCACCCGCGAAAATTCGGCCAGGGTTCTCGCTCTTGTCGTGTCT
GTTCAAACCGGCACGGTCTGATCCGGAAATATGGCCTCAATATGTGCCGCCAGTGTTTCCGTCAGTACGC
GAAGGATATCGGTTTCATTAAGTTGGACTAA


>OriGene 5' read for NM_001032 unedited
NCGGGCCGCGGAATTCCCGGGGAATCGTCGACCCACAGCGTCCGCGGGAGCGTGGGTCGC
CCACGCGTCGGGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCACCCGCGAAAATTCGG
CCAGGGTTCTCGCTCTTGTCGTGTCTGTTCAAACCGGCACGGTCTGATCCGGAAATATGG
CCTCAATATGTGCCGCCAGTGTTTCCGTCAGTACGCGAAGGATATCGGTTTCATTAAGTT
GGACTAAATGCTCTTCCTTCAGAGGATTATCCGGGGCATCTACTCAATGAAAAACCATGA
TAATTCTTTGTATATAAAATAAACATTTGAAAAAACCCTTCTGAAAAGAAAAAAAAGCGA
AAATAGAAGGTGAAGGGGGAGGGGAGACGGGAGGGGGCATATATAACACAAAGCGCGATT
GACACCCAAAAAAGAGGGCGGCCGCGCGCATAGCTGTTTCCTGAACAGATCCCGGGGGGG
ATCCCCGGGGACCCCCCCCAAGGGCCCTTCCGGGCCCTGGGAAGTGCCACTTCCAGGCCC
GACAGCCTGGGGCAAATAAAACAAAGTGCACCCTTTTTGGCGGATAAGGGGACCTTCTAA
ATATAAGGGGGGGGGGGGGGGGCGTTTCGTATTGGCAACCGCGATGAAGACAGACGGGGT
GGCCGCGGGGGCTACTAGCAAGAACAGGGGGTGTTGGGGTGTTTTGTTAGGCCCCACCGA
GCATTTCCCTCCCCCTTGTTTTTGACAGTACCCCCGGCGGCGGCGTTGTAGAGTAAAGGG
GATTCACGCAGGGCCACACCGGGTACAACGAATTTACCCGTTTGTCGGGAGATAATAAGA
GTACTGAGAGAGTAGGGGCGTGGGGGGGGAATGGCTTAAAGC
Restriction Sites Please inquire     
ACCN NM_001032
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001032.3, NP_001023.1
RefSeq Size 302 bp
RefSeq ORF 171 bp
Locus ID 6235
UniProt ID P62273
Protein Pathways Ribosome
Gene Summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit and a member of the S14P family of ribosomal proteins. The protein, which contains a C2-C2 zinc finger-like domain that can bind to zinc, can enhance the tumor suppressor activity of Ras-related protein 1A (KREV1). It is located in the cytoplasm. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2013]
Transcript Variant: This variant (1) is the predominant transcript and encodes isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...