NOX1 (NM_007052) Human Untagged Clone
CAT#: SC123944
NOX1 (untagged)-Human NADPH oxidase 1 (NOX1), transcript variant NOH-1L
CNY 6,312.00
Cited in 2 publications. |
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GP91-2; MOX1; NOH-1; NOH1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_007052 edited
ATGGGAAACTGGGTGGTTAACCACTGGTTTTCAGTTTTGTTTCTGGTTGTTTGGTTAGGG CTGAATGTTTTCCTGTTTGTGGATGCCTTCCTGAAATATGAGAAGGCCGACAAATACTAC TACACAAGAAAAATCCTTGGGTCAACATTGGCCTGTGCCCGAGCGTCTGCTCTCTGCTTG AATTTTAACAGCACGCTGATCCTGCTTCCTGTGTGTCGCAATCTGCTGTCCTTCCTGAGG GGCACCTGCTCATTTTGCAGCCGCACACTGAGAAAGCAATTGGATCACAACCTCACCTTC CACAAGCTGGTGGCCTATATGATCTGCCTACATACAGCTATTCACATCATTGCACACCTG TTTAACTTTGACTGCTATAGCAGAAGCCGACAGGCCACAGATGGCTCCCTTGCCTCCATT CTCTCCAGCCTATCTCATGATGAGAAAAAGGGGGGTTCTTGGCTAAATCCCATCCAGTCC CGAAACACGACAGTGGAGTATGTGACATTCACCAGCATTGCTGGTCTCACTGGAGTGATC ATGACAATAGCCTTGATTCTCATGGTAACTTCAGCTACTGAGTTCATCCGGAGGAGTTAT TTTGAAGTCTTCTGGTATACTCACCACCTTTTTATCTTCTATATCCTTGGCTTAGGGATT CACGGCATTGGTGGAATTGTCCGGGGTCAAACAGAGGAGAGCATGAATGAGAGTCATCCT CGCAAGTGTGCAGAGTCTTTTGAGATGTGGGATGATCGTGACTCTCACTGTAGGCGCCCT AAGTTTGAAGGGCATCCCCCTGAGTCTTGGAAGTGGATCCTTGCACCGGTCATTCTTTAT ATCTGTGAAAGGATCCTCCGGTTTTACCGCTCCCAGCAGAAGGTTGTGATTACCAAGGTT GTTATGCACCCATCCAAAGTTTTGGAATTGCAGATGAACAAGCGTGGCTTCAGCATGGAA GTGGGGCAGTATATCTTTGTTAATTGCCCCTCAATCTCTCTCCTGGAATGGCATCCTTTT ACTTTGACCTCTGCTCCAGAGGAAGATTTCTTCTCCATTCATATCCGAGCAGCAGGGGAC TGGACAGAAAATCTCATAAGGGCTTTCGAACAACAATATTCACCAATTCCCAGGATTGAA GTGGATGGTCCCTTTGGCACAGCCAGTGAGGATGTTTTCCAGTATGAAGTGGCTGTGCTG GTTGGAGCAGGAATTGGGGTCACCCCCTTTGCTTCTATCTTGAAATCCATCTGGTACAAA TTCCAGTGTGCAGACCACAACCTCAAAACAAAAAAGATCTATTTCTACTGGATCTGCAGG GAGACAGGTGCCTTTTCCTGGTTCAACAACCTGTTGACTTCCCTGGAACAGGAGATGGAG GAATTAGGCAAAGTGGGTTTTCTAAACTACCGTCTCTTCCTCACCGGATGGGACAGCAAT ATTGTTGGTCATGCAGCATTAAACTTTGACAAGGCCACTGACATCGTGACAGGTCTGAAA CAGAAAACCTCCTTTGGGAGACCAATGTGGGACAATGAGTTTTCTACAATAGCTACCTCC CACCCCAAGTCTGTAGTGGGAGTTTTCTTATGTGGCCCTCGGACTTTGGCAAAGAGCCTG CGCAAATGCTGTCACCGATATTCCAGTCTGGATCCTAGAAAGGTTCAATTCTACTTCAAC AAAGAAAATTTTTGA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | NotI-NotI |
ACCN | NM_007052 |
Insert Size | 1700 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_007052.3, NP_008983.1 |
RefSeq Size | 2612 bp |
RefSeq ORF | 1695 bp |
Locus ID | 27035 |
UniProt ID | Q9Y5S8 |
Protein Families | Druggable Genome, Ion Channels: Other, Transmembrane |
Protein Pathways | Leukocyte transendothelial migration |
Gene Summary | This gene encodes a member of the NADPH oxidase family of enzymes responsible for the catalytic one-electron transfer of oxygen to generate superoxide or hydrogen peroxide. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2012] Transcript Variant: This variant (1, alternately referred to as NOH-1L per PMID: 10615049) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Citations (2)
The use of this cDNA Clones has been cited in the following citations: |
---|
Selective Recapitulation of Conserved and Non-Conserved Regions of Putative NOXA1 Activation Domain Confers Isoform-Specific Inhibition of Nox1 Oxidase, Attenuation of Endothelial Cell Nox and Migration
,Ranayhossaini, DJ;Rodriguez, AI;Sahoo, S;Chen, BB;Mallampalli, RK;Kelley, EE;Csanyi, G;Gladwin, MT;Romero, G;Pagano, PJ;,
J. Biol. Chem.
,PubMed ID 24187133
[NOX1]
|
Dynamin 2 and c-Abl Are Novel Regulators of Hyperoxia-mediated NADPH Oxidase Activation and Reactive Oxygen Species Production in Caveolin-enriched Microdomains of the Endothelium
,Patrick A. Singleton, Srikanth Pendyala, Irina A. Gorshkova, Nurbek Mambetsariev, Jaideep Moitra, Joe G. N. Garcia, and Viswanathan Natarajan,
J. Biol. Chem., Dec 2009; 284: 34964 - 34975
[NOX1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210426 | NOX1 (Myc-DDK-tagged)-Human NADPH oxidase 1 (NOX1), transcript variant NOH-1L |
CNY 6,296.00 |
|
RC210426L1 | Lenti ORF clone of Human NADPH oxidase 1 (NOX1), transcript variant NOH-1L, Myc-DDK-tagged |
CNY 8,696.00 |
|
RC210426L2 | Lenti ORF clone of Human NADPH oxidase 1 (NOX1), transcript variant NOH-1L, mGFP tagged |
CNY 5,890.00 |
|
RC210426L3 | Lenti ORF clone of Human NADPH oxidase 1 (NOX1), transcript variant NOH-1L, Myc-DDK-tagged |
CNY 8,696.00 |
|
RC210426L4 | Lenti ORF clone of Human NADPH oxidase 1 (NOX1), transcript variant NOH-1L, mGFP tagged |
CNY 8,696.00 |
|
RG210426 | NOX1 (tGFP-tagged) - Human NADPH oxidase 1 (NOX1), transcript variant NOH-1L |
CNY 7,896.00 |