KCNJ1 (NM_000220) Human Untagged Clone
CAT#: SC123920
KCNJ1 (untagged)-Human potassium inwardly-rectifying channel, subfamily J, member 1 (KCNJ1), transcript variant rom-k1
CNY 5,488.00
Cited in 1 publication. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | KIR1.1; ROMK; ROMK1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_000220, the custom clone sequence may differ by one or more nucleotides
ATGAATGCTTCCAGTCGGAATGTGTTTGACACGTTGATCAGGGTGTTGACAGAAAGTATGTTCAAACATC TTCGGAAATGGGTCGTCACTCGCTTTTTTGGGCATTCTCGGCAAAGAGCAAGGCTAGTCTCCAAAGATGG AAGGTGCAACATAGAATTTGGCAATGTGGAGGCACAGTCAAGGTTTATATTCTTTGTGGACATCTGGACA ACGGTACTTGACCTCAAGTGGAGATACAAAATGACCATTTTCATCACAGCCTTCTTGGGGAGTTGGTTTT TCTTTGGTCTCCTGTGGTATGCAGTAGCGTACATTCACAAAGACCTCCCGGAATTCCATCCTTCTGCCAA TCACACTCCCTGTGTGGAGAATATTAATGGCTTGACCTCAGCTTTTCTGTTTTCTCTGGAGACTCAAGTG ACCATTGGATATGGATTCAGGTGTGTGACAGAACAGTGTGCCACTGCCATTTTTCTGCTTATCTTTCAGT CTATACTTGGAGTTATAATCAATTCTTTCATGTGTGGGGCCATCTTAGCCAAGATCTCCAGGCCCAAAAA ACGTGCCAAGACCATTACGTTCAGCAAGAACGCAGTGATCAGCAAACGGGGAGGGAAGCTTTGCCTCCTA ATCCGAGTGGCTAATCTCAGGAAGAGCCTTCTTATTGGCAGTCACATTTATGGAAAGCTTCTGAAGACCA CAGTCACTCCTGAAGGAGAGACCATTATTTTGGACCAGATCAATATCAACTTTGTAGTTGACGCTGGGAA TGAAAATTTATTCTTCATCTCCCCATTGACAATTTACCATGTCATTGATCACAACAGCCCTTTCTTCCAC ATGGCAGCGGAGACCCTTCTCCAGCAGGACTTTGAATTAGTGGTGTTTTTAGATGGCACAGTGGAGTCCA CCAGTGCTACCTGCCAAGTCCGGACATCCTATGTCCCAGAGGAGGTGCTTTGGGGCTACCGTTTTGCTCC CATAGTATCCAAGACAAAGGAAGGGAAATACCGAGTGGATTTCCATAACTTTAGCAAGACAGTGGAAGTG GAGACCCCTCACTGTGCCATGTGCCTTTATAATGAGAAAGATGTTAGAGCCAGGATGAAGAGAGGCTATG ACAACCCCAACTTCATCTTGTCAGAAGTCAATGAAACAGATGACACCAAAATGTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | Please inquire |
ACCN | NM_000220 |
Insert Size | 2200 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_000220.2, NP_000211.1 |
RefSeq Size | 2332 bp |
RefSeq ORF | 1176 bp |
Locus ID | 3758 |
UniProt ID | P48048 |
Protein Families | Druggable Genome, Ion Channels: Potassium, Transmembrane |
Gene Summary | Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. It is activated by internal ATP and probably plays an important role in potassium homeostasis. The encoded protein has a greater tendency to allow potassium to flow into a cell rather than out of a cell. Mutations in this gene have been associated with antenatal Bartter syndrome, which is characterized by salt wasting, hypokalemic alkalosis, hypercalciuria, and low blood pressure. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1, also known as rom-k1) encodes the longest isoform (a). |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Development of a Selective Small-Molecule Inhibitor of Kir1.1, the Renal Outer Medullary Potassium Channel
,Gautam Bhave, Brian A. Chauder, Wen Liu, Eric S. Dawson, Rishin Kadakia, Thuy T. Nguyen, L. Michelle Lewis, Jens Meiler, C. David Weaver, Lisa M. Satlin, Craig W. Lindsley, and Jerod S. Denton,
Mol. Pharmacol., Jan 2011; 79: 42 - 50
[KCNJ1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223353 | KCNJ1 (Myc-DDK-tagged)-Human potassium inwardly-rectifying channel, subfamily J, member 1 (KCNJ1), transcript variant rom-k1 |
CNY 5,488.00 |
|
RC223353L3 | Lenti ORF clone of Human potassium inwardly-rectifying channel, subfamily J, member 1 (KCNJ1), transcript variant rom-k1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC223353L4 | Lenti ORF clone of Human potassium inwardly-rectifying channel, subfamily J, member 1 (KCNJ1), transcript variant rom-k1, mGFP tagged |
CNY 5,890.00 |
|
RG223353 | KCNJ1 (tGFP-tagged) - Human potassium inwardly-rectifying channel, subfamily J, member 1 (KCNJ1), transcript variant rom-k1 |
CNY 7,088.00 |