CLEC1B (NM_016509) Human Untagged Clone

CAT#: SC122848

CLEC1B (untagged)-Human C-type lectin domain family 1, member B (CLEC1B), transcript variant 1



  "NM_016509" in other vectors (4)

CN¥ 2,640.00

CN¥ 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00


CLEC1B rabbit polyclonal antibody
    • 25 ul

CN¥ 800.00
CN¥ 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 1810061I13Rik; CLEC2; CLEC2B; PRO1384; QDED721
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_016509, the custom clone sequence may differ by one or more nucleotides


ATGCAGGATGAAGATGGATACATCACCTTAAATATTAAAACTCGGAAACCAGCTCTCATCTCCGTTGGCT
CTGCATCCTCCTCCTGGTGGCGTGTGATGGCTTTGATTCTGCTGATCCTGTGCGTGGGGATGGTTGTCGG
GCTGGTGGCTCTGGGGATTTGGTCTGTCATGCAGCGCAATTACCTACAAGGTGAGAATGAAAATCGCACA
GGAACTCTGCAACAATTAGCAAAGCGCTTCTGTCAATATGTGGTAAAACAATCAGAACTAAAGGGCACTT
TCAAAGGTCATAAATGCAGCCCCTGTGACACAAACTGGAGATATTATGGAGATAGCTGCTATGGGTTCTT
CAGGCACAACTTAACATGGGAAGAGAGTAAGCAGTACTGCACTGACATGAATGCTACTCTCCTGAAGATT
GACAACCGGAACATTGTGGAGTACATCAAAGCCAGGACTCATTTAATTCGTTGGGTCGGATTATCTCGCC
AGAAGTCGAATGAGGTCTGGAAGTGGGAGGATGGCTCGGTTATCTCAGAAAATATGTTTGAGTTTTTGGA
AGATGGAAAAGGAAATATGAATTGTGCTTATTTTCATAATGGGAAAATGCACCCTACCTTCTGTGAGAAC
AAACATTATTTAATGTGTGAGAGGAAGGCTGGCATGACCAAGGTGGACCAACTACCTTAA


Restriction Sites Please inquire     
ACCN NM_016509
Insert Size 945 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_016509.2, NP_057593.2
RefSeq Size 963 bp
RefSeq ORF 690 bp
Locus ID 51266
UniProt ID Q9P126
Protein Families Druggable Genome, Transmembrane
Gene Summary Natural killer (NK) cells express multiple calcium-dependent (C-type) lectin-like receptors, such as CD94 (KLRD1; MIM 602894) and NKG2D (KLRC4; MIM 602893), that interact with major histocompatibility complex class I molecules and either inhibit or activate cytotoxicity and cytokine secretion. CLEC2 is a C-type lectin-like receptor expressed in myeloid cells and NK cells (Colonna et al., 2000 [PubMed 10671229]).[supplied by OMIM, Jan 2011]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...