United States
Germany
Japan
United Kingdom
China
SAT2 (NM_133491) Human Untagged Clone
CAT＃: SC120524
SAT2 (untagged)-Human spermidine/spermine N1-acetyltransferase family member 2 (SAT2)
CNY 3,600.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | SSAT2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_133491, the custom clone sequence may differ by one or more nucleotides
ATGGCTTCCGTGCGGATCCGAGAGGCCAAGGAGGGAGACTGTGGAGATATCCTGAGGCTGATTCGGGAGC TAGCCGAATTCGAAAAACTCTCGGATCAGGTGAAGATCAGTGAAGAAGCCCTGAGAGCAGATGGCTTTGG AGACAATCCTTTCTATCACTGTTTGGTAGCAGAGATTCTTCCAGCGCCCGGGAAGCTACTGGGGCCCTGC GTGGTGGGCTATGGGATATACTATTTCATCTACAGTACATGGAAGGGACGCACCATTTATCTGGAGGATA TCTATGTGATGCCGGAATATCGGGGTCAAGGGATTGGTTCCAAAATAATCAAAAAGGTGGCTGAGGTGGC CTTGGATAAGGGCTGCTCCCAATTCCGCCTGGCCGTCCTGGACTGGAACCAGAGGGCCATGGACTTGTAC AAGGCCCTAGGAGCCCAAGATCTGACGGAAGCTGAGGGCTGGCACTTCTTCTGCTTTCAAGGAGAGGCAA CGAGAAAGTTGGCAGGAAAGTGA |
| Chromatograms |
CHROMATOGRAMS
 Sequencher program is needed, download here. |
| Restriction Sites | NotI-NotI |
| ACCN | NM_133491 |
| Insert Size | 1650 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_133491.2, NP_597998.1 |
| RefSeq Size | 953 bp |
| RefSeq ORF | 513 bp |
| Locus ID | 112483 |
| UniProt ID | Q96F10 |
| Domains | Acetyltransf |
| Protein Pathways | Arginine and proline metabolism, Metabolic pathways |
| Gene Summary | Enzyme which catalyzes the acetylation of polyamines. Substrate specificity: norspermidine > spermidine = spermine >> N(1)acetylspermine = putrescine.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) uses an alternate 5' terminal exon, resulting in a novel 5' UTR and the use of an alternate start codon, compared to variant 1. The encoded isoform (3) has a distinct N-terminus, and is shorter than isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC204044 | SAT2 (Myc-DDK-tagged)-Human spermidine/spermine N1-acetyltransferase family member 2 (SAT2) |
CNY 3,600.00 |
|
| RC204044L3 | Lenti ORF clone of Human spermidine/spermine N1-acetyltransferase family member 2 (SAT2), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC204044L4 | Lenti ORF clone of Human spermidine/spermine N1-acetyltransferase family member 2 (SAT2), mGFP tagged |
CNY 5,890.00 |
|
| RG204044 | SAT2 (tGFP-tagged) - Human spermidine/spermine N1-acetyltransferase family member 2 (SAT2) |
CNY 5,200.00 |
