United States
Germany
Japan
United Kingdom
China
MICA (NM_000247) Human Untagged Clone
CAT＃: SC120030
MICA (untagged)-Human MHC class I polypeptide-related sequence A (MICA), transcript variant 1 (allele MICA*001)
CNY 5,488.00
| Cited in 1 publication. |
Product images
CNY 1,999.00
CNY 3,600.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | MIC-A; PERB11.1 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_000247 edited
CGCCTTCTCCCCGGCCACTGCTTGAGCCGCTGAGAGGGTGGCGACGTCGGGGCCATGGGG CTGGGCCCGGTCTTCCTGCTTCTGGCTGGCATCTTCCCTTTTGCACCTCCGGGAGCTGCT GCTGAGCCCCACAGTCTTCGTTATAACCTCACGGTGCTGTCCTGGGATGGATCTGTGCAG TCAGGGTTTCTCACTGAGGTACATCTGGATGGTCAGCCCTTCCTGCGCTGTGACAGGCAG AAATGCAGGGCAAAGCCCCAGGGACAGTGGGCAGAAGATGTCCTGGGAAATAAGACATGG GACAGAGAGACCAGAGACTTGACAGGGAACGGAAAGGACCTCAGGATGACCCTGGCTCAT ATCAAGGACCAGAAAGAAGGCTTGCATTCCCTCCAGGAGATTAGGGTCTGTGAGATCCAT GAAGACAACAGCACCAGGAGCTCCCAGCATTTCTACTACGATGGGGAGCTCTTCCTCTCC CAAAACCTGGAGACTGAGGAATGGACAATGCCCCAGTCCTCCAGAGCTCAGACCTTGGCC ATGAACGTCAGGAATTTCTTGAAGGAAGATGCCATGAAGACCAAGACACACTATCACGCT ATGCATGCAGACTGCCTGCAGGAACTACGGCGATATCTAAAATCCGGCGTAGTCCTGAGG AGAACAGTGCCCCCCATGGTGAATGTCACCCGCAGCGAGGCCTCAGAGGGCAACATTACC GTGACATGCAGGGCTTCTGGCTTCTATCCCTGGAATATCACACTGAGCTGGCGTCAGGAT GGGGTATCTTTGAGCCACGACACCCAGCAGTGGGGGGATGTCCTGCCTGATGGGAATGGA ACCTACCAGACCTGGGTGGCCACCAGGATTTGCCAAGGAGAGGAGCAGAGGTTCACCTGC TACATGGAACACAGCGGGAATCACAGCACTCACCCTGTGCCCTCTGGGAAAGTGCTGGTG CTTCAGAGTCATTGGCAGACATTCCATGTTTCTGCTGTTGCTGCTGCTGCTATTTTTGTT ATTATTATTTTCTATGTCCGTTGTTGTAAGAAGAAAACATCAGCTGCAGAGGGTCCAGAG CTCGTGAGCCTGCAGGTCCTGGATCAACACCCAGTTGGGACGAGTGACCACAGGGATGCC ACACAGCTCGGATTTCAGCCTCTGATGTCAGATCTTGGGTCCACTGGCTCCACTGAGGGC ACCTAGACTCTACAGCCAGGCAGCTGGGATTCAATTCCCTGCCTGGATCTCACGAGCACT TTCCCTCTTGGTGCCTCAGTTTCCTGACCTATGAAACAGAGAAAATAAAAGCACTTATTT ATTGTTAAAAAAAAAAAAAAA |
| Restriction Sites | ECoRI-NOT |
| ACCN | NM_000247 |
| Insert Size | 1340 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000247.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_000247.1, NP_000238.1 |
| RefSeq Size | 1365 bp |
| RefSeq ORF | 1152 bp |
| Locus ID | 100507436 |
| UniProt ID | Q29983 |
| Domains | MHC_I, IGc1 |
| Gene Summary | This gene encodes the highly polymorphic major histocompatability complex class I chain-related protein A. The protein product is expressed on the cell surface, although unlike canonical class I molecules it does not seem to associate with beta-2-microglobulin. It is a ligand for the NKG2-D type II integral membrane protein receptor. The protein functions as a stress-induced antigen that is broadly recognized by intestinal epithelial gamma delta T cells. Variations in this gene have been associated with susceptibility to psoriasis 1 and psoriatic arthritis, and the shedding of MICA-related antibodies and ligands is involved in the progression from monoclonal gammopathy of undetermined significance to multiple myeloma. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2014] Transcript Variant: This variant (1*001, also known as 1) is derived from the MICA*001 allele. It encodes the longest isoform (1). The MICA*001 allele is found in the c6_QBL (ALT_REF_LOCI_6) alternate assembly. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Evasion of Innate Immunity Contributes to Small Cell Lung Cancer Progression and Metastasis
,Zhu, M;Huang, Y;Bender, ME;Girard, L;Kollipara, R;Eglenen-Polat, B;Naito, Y;Savage, TK;Huffman, KE;Koyama, S;Kumanogoh, A;Minna, JD;Johnson, JE;Akbay, EA;,
Cancer research
,PubMed ID 33495232
[MICA]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC204447 | MICA (Myc-DDK-tagged)-Human MHC class I polypeptide-related sequence A (MICA), transcript variant 1 (allele MICA*001) |
CNY 5,488.00 |
|
| RC204447L1 | Lenti ORF clone of Human MHC class I polypeptide-related sequence A (MICA), transcript variant 1 (allele MICA*001), Myc-DDK-tagged |
CNY 7,888.00 |
|
| RC204447L2 | Lenti ORF clone of Human MHC class I polypeptide-related sequence A (MICA), transcript variant 1 (allele MICA*001), mGFP tagged |
CNY 5,890.00 |
|
| RC204447L3 | Lenti ORF clone of Human MHC class I polypeptide-related sequence A (MICA), transcript variant 1 (allele MICA*001), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC204447L4 | Lenti ORF clone of Human MHC class I polypeptide-related sequence A (MICA), transcript variant 1 (allele MICA*001), mGFP tagged |
CNY 7,888.00 |
|
| RG204447 | MICA (tGFP-tagged) - Human MHC class I polypeptide-related sequence A (MICA), transcript variant 1 (allele MICA*001) |
CNY 7,088.00 |
|
| SC323924 | MICA (untagged)-Human MHC class I polypeptide-related sequence A (MICA), transcript variant 1 (allele MICA*001) |
CNY 5,488.00 |
