Cholecystokinin (CCK) (NM_000729) Human Untagged Clone

CAT#: SC119730

CCK (untagged)-Human cholecystokinin (CCK), transcript variant 1



  "NM_000729" in other vectors (4)

CNY 1,200.00

CNY 2,950.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-CCK Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_000729 edited
ATGAACAGCGGCGTGTGCCTGTGCGTGCTGATGGCGGTACTGGCGGCTGGCGCCCTGACG
CAGCCGGTGCCTCCCGCAGATCCCGCGGGCTCCGGGCTGCAGCGGGCAGAGGAGGCGCCC
CGTAGGCAGCTGAGGGTATCGCAGAGAACGGATGGCGAGTCCCGAGCGCACCTGGGCGCC
CTGCTGGCAAGATACATCCAGCAGGCCCGGAAAGCTCCTTCTGGACGAATGTCCATCGTT
AAGAACCTGCAGAACCTGGACCCCAGCCACAGGATAAGTGACCGGGACTACATGGGCTGG
ATGGATTTTGGCCGTCGCAGTGCCGAGGAGTATGAGTACCCCTCCTAG
>OriGene 5' read for NM_000729 unedited
CACGAGGCCGGGCTGCTCCGGTTGGAAACGCCAAGCCAGCTGCGTCCTAATCCAAAAGCC
ATGAACAGCGGCGTGTGCCTGTGCGTGCTGATGGCGGTACTGGCGGCTGGCGCCCTGACG
CANCCGGTGCCTCCCGCAGATCCCGCGGGCTCCGGGCTGCAGCGGGCAGAGGAGGCGCCC
CGTAGGCAGCTGAGGGTATCGCAGAGAACGGATGGCGAGTCCCGAGCGCACCTGGGCGCC
CTGCTGGCAAGATACATCCAGCAGGCCCGGAAAGCTCCTTCTGGACGAATGTCCATCGTT
AAGAACCTGCAGAACCTGGACCCCAGCCACAGGATAAGTGACCGGGACTACATGGGCTGG
ATGGATTTTGGCCGTCGCAGTGCCGAGGAGTATGAGTACCCCTCCTAGAGGACCCAGCCG
CCATCAGCCCAACGGGAAGCAACCTCCCAACCCAGAGGAGGCAGAATAAGAAAACAATCA
CACTCATAACTCATTGTCTGGTGGGAGTTTGACATTGTATGTATCTATTNAATTAAGTTC
TCAATGTGAAAN
Restriction Sites NotI-NotI     
ACCN NM_000729
Insert Size 800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_000729.3, NP_000720.1
RefSeq Size 851 bp
RefSeq ORF 348 bp
Locus ID 885
UniProt ID P06307
Domains Gastrin
Protein Families Druggable Genome, Secreted Protein
Gene Summary This gene encodes a member of the gastrin/cholecystokinin family of proteins. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the peptide hormones cholecystokinin-8, -12, -33, and others. The encoded peptides have been shown to regulate gastric acid secretion and food intake. A sulfated form of cholecystokinin-8 may modulate neuronal activity in the brain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...