HSBP1 (NM_001537) Human Untagged Clone

CAT#: SC119194

HSBP1 (untagged)-Human heat shock factor binding protein 1 (HSBP1)



  "NM_001537" in other vectors (6)

CNY 1,200.00

CNY 2,950.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit monoclonal anti-HSBP1 antibody for SISCAPA, clone OTIR5C4
    • 100 ul

CNY 4,390.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NPC-A-13
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001537, the custom clone sequence may differ by one or more nucleotides


ATGGCCGAGACTGACCCCAAGACCGTGCAGGACCTCACCTCGGTGGTGCAGACACTCCTGCAGCAGATGC
AAGATAAATTTCAGACCATGTCTGACCAGATCATTGGGAGAATTGATGATATGAGTAGTCGCATTGATGA
TCTGGAAAAGAATATCGCGGACCTCATGACACAGGCTGGGGTGGAAGAACTGGAAAGTGAAAACAAGATA
CCTGCCACGCAAAAGAGTTGA


>OriGene 5' read for NM_001537 unedited
GTTGCATTTGTATACGACTCCTATAGGCGGCCGCGNAATTCGCACGAGGGGAAGTGTAGG
TTACGGTCTGAGACTCACCGCCAAGCTGGGCATCGGGGAGATGGCCGAGACTGACCCCAA
GACCGTGCAGGACCTCACCTCGGTGGTGCAGACACTCCTGCAGCAGATGCAAGATAAATT
TCAGACCATGTCTGACCAGATCATTGGGAGAATTGATGATATGAGTAGTCGCATTGATGA
TCTGGAAAAGAATATCGCGGACCTCATGACACAGGCTGGGGTGGAAGAACTGGAAAGTGA
AAACAAGATACCTGCCACGCAAAAGAGTTGAAGGTTGCTAATAATTTATACTGGAATCTG
GCATTTTTCCAAGCCAAGAGAAGATCGAATGGCTTTTTGCAGCTAACTACTATGTGTAGA
CAGGTTTTATATTATAAAGTATGCATTCTTATCACCTAGTATATAGTTAGTTTGTAGAGT
GATTTCCCCCCAGTTTCTTGAACATGGTATCTTCACATCTTGGACCTTGGTCAGTTGTGC
TATTCATTATTAAACACTAAAACTTTGGCGGTTCTTGCATAACATTGTCAGATTTTTTAG
TGTATTTCTGTGAAGTCATTTTTTTTCTTGTCATTCCTTTTGTAGTAGTTGCTGTTTGGA
TAAAAGTTGATGTGTGATTTTTTATTAAACAAATAGTAAACCCTTCAATTATAGTTAGTC
TTGGTGAAGTAAGATGTTTGTAGACTTTAGAGTTCTTTAATTCTTGGCACAACGTGACTG
TTGAGCTAACACCANATAGTGTGTTGGCAATACTTTTCAAATGGCTGAACACACCTAAAA
ATTGTCATCCAGAATATCTGTCACTGCTCTGTTGCCAAACTCAGATAGAACTTANACTAT
GTCTGAGTCCCTGAGATCACTGCTAAGTCGAT
Restriction Sites NotI-NotI     
ACCN NM_001537
Insert Size 1960 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001537.2, NP_001528.1
RefSeq Size 1919 bp
RefSeq ORF 231 bp
Locus ID 3281
UniProt ID O75506
Protein Families Transcription Factors
Gene Summary The heat-shock response is elicited by exposure of cells to thermal and chemical stress and through the activation of HSFs (heat shock factors) results in the elevated expression of heat-shock induced genes. Heat shock factor binding protein 1 (HSBP1), is a 76-amino-acid protein that binds to heat shock factor 1(HSF1), which is a transcription factor involved in the HS response. During HS response, HSF1 undergoes conformational transition from an inert non-DNA-binding monomer to active functional trimers. HSBP1 is nuclear-localized and interacts with the active trimeric state of HSF1 to negatively regulate HSF1 DNA-binding activity. Overexpression of HSBP1 in mammalian cells represses the transactivation activity of HSF1. When overexpressed in C.elegans HSBP1 has severe effects on survival of the animals after thermal and chemical stress consistent with a role of HSBP1 as a negative regulator of heat shock response. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...