United States
Germany
Japan
United Kingdom
China
ATF 4 (ATF4) (NM_001675) Human Untagged Clone
CAT＃: SC119103
ATF4 (untagged)-Human activating transcription factor 4 (tax-responsive enhancer element B67) (ATF4), transcript variant 1
CNY 5,488.00
| Cited in 4 publications. |
Product images
CNY 1,999.00
CNY 3,600.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CREB-2; CREB2; TAXREB67; TXREB |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001675 edited
CTTCTCACGGCATTCAGCAGCAGCGTTGCTGTAACCGACAAAGACACCTTCGAATTAAGC ACATTCCTCGATTCCAGCAAAGCACCGCAACATGACCGAAATGAGCTTCCTGAGCAGCGA GGTGTTGGTGGGGGACTTGATGTCCCCCTTCGACCCGTCGGGTTTGGGGGCTGAAGAAAG CCTAGGTCTCTTAGATGATTACCTGGAGGTGGCCAAGCACTTCAAACCTCATGGGTTCTC CAGCGACAAGGCTAAGGCGGGCTCCTCCGAATGGCTGGCTGTGGATGGGTTGGTCAGTCC CTCCAACAACAGCAAGGAGGATGCCTTCTCCGGGACAGATTGGATGTTGGAGAAAATGGA TTTGAAGGAGTTCGACTTGGATGCCCTGTTGGGTATAGATGACCTGGAAACCATGCCAGA TGACCTTCTGACCACGTTGGATGACACTTGTGATCTCTTTGCCCCCCTAGTCCAGGAGAC TAATAAGCAGCCCCCCCAGACGGTGAACCCAATTGGCCATCTCCCAGAAAGTTTAACAAA ACCCGACCAGGTTGCCCCCTTCACCTTCTTACAACCTCTTCCCCTTTCCCCAGGGGTCCT GTCCTCCACTCCAGATCATTCCTTTAGTTTAGAGCTGGGCAGTGAAGTGGATATCACTGA AGGAGATAGGAAGCCAGACTACACTGCTTACGTTGCCATGATCCCTCAGTGCATAAAGGA GGAAGACACCCCTTCAGATAATGATAGTGGCATCTGTATGAGCCCAGAGTCCTATCTGGG GTCTCCTCAGCACAGCCCCTCTACCAGGGGCTCTCCAAATAGGAGCCTCCCATCTCCAGG TGTTCTCTGTGGGTCTGCCCGTCCCAAACCTTACGATCCTCCTGGAGAGAAGATGGTAGC AGCAAAAGTAAAGGGTGAGAAACTGGATAAGAAGCTGAAAAAAATGGAGCAAAACAAGAC AGCAGCCACTAGGTACCGCCAGAAGAAGAGGGCGGAGCAGGAGGCTCTTACTGGTGAGTG CAAAGAGCTGGAAAAGAAGAACGAGGCTCTAAAAGAGAGGGCGGATTCCCTGGCCAAGGA GATCCAGTACCTGAAAGATTTGATAGAAGAGGTCCGCAAGGCAAGGGGGAAGAAAAGGGT CCCCTAGTTGAGGATAGTCAGGAGCGTCAATGTGCTTGTACATAGAGTGCTGTAGCTGTG TGTTCCAATAAATTATTTTGTAGGGAAAAAAAAAAAAAAAA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_001675 |
| Insert Size | 1200 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | A TrueClone. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001675.2, NP_001666.2 |
| RefSeq Size | 2022 bp |
| RefSeq ORF | 1056 bp |
| Locus ID | 468 |
| UniProt ID | P18848 |
| Domains | BRLZ |
| Protein Families | Transcription Factors |
| Protein Pathways | GnRH signaling pathway, Long-term potentiation, MAPK signaling pathway, Neurotrophin signaling pathway, Prostate cancer |
| Gene Summary | This gene encodes a transcription factor that was originally identified as a widely expressed mammalian DNA binding protein that could bind a tax-responsive enhancer element in the LTR of HTLV-1. The encoded protein was also isolated and characterized as the cAMP-response element binding protein 2 (CREB-2). The protein encoded by this gene belongs to a family of DNA-binding proteins that includes the AP-1 family of transcription factors, cAMP-response element binding proteins (CREBs) and CREB-like proteins. These transcription factors share a leucine zipper region that is involved in protein-protein interactions, located C-terminal to a stretch of basic amino acids that functions as a DNA binding domain. Two alternative transcripts encoding the same protein have been described. Two pseudogenes are located on the X chromosome at q28 in a region containing a large inverted duplication. [provided by RefSeq, Sep 2011] Transcript Variant: This variant (1) represents the longer transcript. The protein translation of this variant is regulated by an internal ribosome entry site (PMID: 23665047). Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Citations (4)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Endoplasmic reticulum stress induced by tunicamycin increases resistin messenger ribonucleic acid through the pancreatic endoplasmic reticulum eukaryotic initiation factor 2α kinase–activating transcription factor 4–CAAT/enhancer binding protein‐α homologous protein pathway in THP‐1 human monocytes
,null,
Journal of Diabetes Investigation
,PubMed ID 27330716
[ATF4]
|
|
Hepatitis C virus core protein activates autophagy through EIF2AK3 and ATF6 UPR pathway-mediated MAP1LC3B and ATG12 expression
,null,
Autophagy
,PubMed ID 24589849
[ATF4]
|
|
The involvement of endoplasmic reticulum stress in the suppression of colorectal tumorigenesis by tolfenamic acid
,Zhang, X;Lee, SH;Min, KW;McEntee, MF;Jeong, J;Li, Q;Baek, SJ;,
Cancer Prev Res (Phila). 2013 Nov 19.
,PubMed ID 24104354
[ATF4]
|
|
Regulation of Endoplasmic Reticulum Stress-induced Cell Death by ATF4 in Neuroectodermal Tumor Cells
,Jane L. Armstrong, Ross Flockhart, Gareth J. Veal, Penny E. Lovat, and Christopher P. F. Redfern,
J. Biol. Chem., Feb 2010; 285: 6091 - 6100
[ATF4]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC222709 | ATF4 (Myc-DDK-tagged)-Human activating transcription factor 4 (tax-responsive enhancer element B67) (ATF4), transcript variant 1 |
CNY 5,488.00 |
|
| RC222709L1 | Lenti-ORF clone of ATF4 (Myc-DDK-tagged)-Human activating transcription factor 4 (tax-responsive enhancer element B67) (ATF4), transcript variant 1 |
CNY 7,888.00 |
|
| RC222709L2 | Lenti-ORF clone of ATF4 (mGFP-tagged)-Human activating transcription factor 4 (tax-responsive enhancer element B67) (ATF4), transcript variant 1 |
CNY 7,888.00 |
|
| RC222709L3 | Lenti-ORF clone of ATF4 (Myc-DDK-tagged)-Human activating transcription factor 4 (tax-responsive enhancer element B67) (ATF4), transcript variant 1 |
CNY 7,888.00 |
|
| RC222709L4 | Lenti-ORF clone of ATF4 (mGFP-tagged)-Human activating transcription factor 4 (tax-responsive enhancer element B67) (ATF4), transcript variant 1 |
CNY 7,888.00 |
|
| RG222709 | ATF4 (tGFP-tagged) - Human activating transcription factor 4 (tax-responsive enhancer element B67) (ATF4), transcript variant 1 |
CNY 7,088.00 |
