United States
Germany
Japan
United Kingdom
China
MEIS1 (NM_002398) Human Untagged Clone
CAT＃: SC118668
MEIS1 (untagged)-Human Meis homeobox 1 (MEIS1)
CNY 5,488.00
| Cited in 2 publications. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_002398, the custom clone sequence may differ by one or more nucleotides
ATGGCGCAAAGGTACGACGATCTACCCCATTACGGGGGCATGGATGGAGTAGGCATCCCCTCCACGATGT ATGGGGACCCGCATGCAGCCAGGTCCATGCAGCCGGTCCACCACCTGAACCACGGGCCTCCTCTGCACTC GCATCAGTACCCGCACACAGCTCATACCAACGCCATGGCCCCCAGCATGGGCTCCTCTGTCAATGACGCT TTAAAGAGAGATAAAGATGCCATTTATGGACACCCCCTCTTCCCTCTCTTAGCACTGATTTTTGAGAAAT GTGAATTAGCTACTTGTACCCCCCGCGAGCCGGGGGTGGCGGGCGGGGACGTCTGCTCGTCAGAGTCATT CAATGAAGATATAGCCGTGTTCGCCAAACAGATTCGCGCAGAAAAACCTCTATTTTCTTCTAATCCAGAA CTGGATAACTTGATGATTCAAGCCATACAAGTATTAAGGTTTCATCTATTGGAATTAGAGAAGGTACACG AATTATGTGACAATTTCTGCCACCGGTATATTAGCTGTTTGAAAGGGAAAATGCCTATCGATTTGGTGAT AGACGATAGAGAAGGAGGATCAAAATCAGACAGTGAAGATATAACAAGATCAGCAAATCTAACTGACCAG CCCTCTTGGAACAGAGATCATGATGACACGGCATCTACTCGTTCAGGAGGAACCCCAGGCCCTTCCAGCG GTGGCCACACGTCACACAGTGGGGACAACAGCAGTGAGCAAGGTGATGGCTTGGACAACAGTGTAGCTTC CCCCAGCACAGGTGACGATGATGACCCTGATAAGGACAAAAAGCGTCACAAAAAGCGTGGCATCTTTCCC AAAGTAGCCACAAATATCATGAGGGCGTGGCTGTTCCAGCATCTAACACACCCTTACCCTTCTGAAGAAC AGAAAAAGCAGTTGGCACAAGACACGGGACTCACCATCCTTCAAGTGAACAATTGGTTTATTAATGCCCG GAGAAGAATAGTGCAGCCCATGATAGACCAGTCCAACCGAGCAGTAAGTCAAGGAACACCTTATAATCCT GATGGACAGCCCATGGGAGGTTTCGTAATGGACGGTCAGCAACATATGGGAATTAGAGCACCAGGACCTA TGAGTGGAATGGGCATGAATATGGGCATGGAGGGGCAGTGGCACTACATGTAA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_002398 |
| Insert Size | 4700 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_002398.2, NP_002389.1 |
| RefSeq Size | 3198 bp |
| RefSeq ORF | 1173 bp |
| Locus ID | 4211 |
| UniProt ID | O00470 |
| Domains | homeobox |
| Protein Families | Transcription Factors |
| Gene Summary | Homeobox genes, of which the most well-characterized category is represented by the HOX genes, play a crucial role in normal development. In addition, several homeoproteins are involved in neoplasia. This gene encodes a homeobox protein belonging to the TALE ('three amino acid loop extension') family of homeodomain-containing proteins. [provided by RefSeq, Jul 2008] |
Citations (2)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
The homeodomain transcription factor MEIS1 triggers chemokine expression and is involved in CD8+ T-lymphocyte infiltration in early stage ovarian cancer
,Karapetsas, A;Tokamani, M;Evangelou, C;Sandaltzopoulos, R;,
Mol. Carcinog.
,PubMed ID 29802738
[MEIS1]
|
|
Transcription Factors with Conserved Binding Sites Near ATOH1 on the POU4F3 Gene Enhance the Induction of Cochlear Hair Cells
,Ikeda, R;Pak, K;Chavez, E;Ryan, AF;,
Mol. Neurobiol. July 2014
,PubMed ID 25015561
[MEIS1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC208135 | MEIS1 (Myc-DDK-tagged)-Human Meis homeobox 1 (MEIS1) |
CNY 3,656.00 |
|
| RC208135L1 | Lenti-ORF clone of MEIS1 (Myc-DDK-tagged)-Human Meis homeobox 1 (MEIS1) |
CNY 6,056.00 |
|
| RC208135L2 | Lenti-ORF clone of MEIS1 (mGFP-tagged)-Human Meis homeobox 1 (MEIS1) |
CNY 6,056.00 |
|
| RC208135L3 | Lenti-ORF clone of MEIS1 (Myc-DDK-tagged)-Human Meis homeobox 1 (MEIS1) |
CNY 6,056.00 |
|
| RC208135L4 | Lenti-ORF clone of MEIS1 (mGFP-tagged)-Human Meis homeobox 1 (MEIS1) |
CNY 5,890.00 |
|
| RG208135 | MEIS1 (tGFP-tagged) - Human Meis homeobox 1 (MEIS1) |
CNY 5,256.00 |
