TNFRSF4 (NM_003327) Human Untagged Clone

CAT#: SC118037

TNFRSF4 (untagged)-Human tumor necrosis factor receptor superfamily, member 4 (TNFRSF4)



  "NM_003327" in other vectors (6)

CNY 3,600.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (3)
TNFRSF4 mouse monoclonal antibody,clone OTI2F12A2
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ACT35; CD134; IMD16; OX40; TXGP1L
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_003327 edited
CCGCAAGGAAAACCCAGACTCTGGCGACAGCAGAGACGAGGATGTGCGTGGGGGCTCGGC
GGCTGGGCCGCGGGCCGTGTGCGGCTCTGCTCCTCCTGGGCCTGGGGCTGAGCACCGTGA
CGGGGCTCCACTGTGTCGGGGACACCTACCCCAGCAACGACCGGTGCTGCCACGAGTGCA
GGCCAGGCAACGGGATGGTGAGCCGCTGCAGCCGCTCCCAGAACACGGTGTGCCGTCCGT
GCGGGCCGGGCTTCTACAACGACGTGGTCAGCTCCAAGCCGTGCAAGCCCTGCACGTGGT
GTAACCTCAGAAGTGGGAGTGAGCGGAAGCAGCTGTGCACGGCCACACAGGACACAGTCT
GCCGCTGCCGGGCGGGCACCCAGCCCCTGGACAGCTACAAGCCTGGAGTTGACTGTGCCC
CCTGCCCTCCAGGGCACTTCTCCCCAGGCGACAACCAGGCCTGCAAGCCCTGGACCAACT
GCACCTTGGCTGGGAAGCACACCCTGCAGCCGGCCAGCAATAGCTCGGACGCAATCTGTG
AGGACAGGGACCCCCCAGCCACGCAGCCCCAGGAGACCCAGGGCCCCCCGGCCAGGCCCA
TCACTGTCCAGCCCACTGAAGCCTGGCCCAGAACCTCACAGGGACCCTCCACCCGGCCCG
TGGAGGTCCCCGGGGGCCGTGCGGTTGCCGCCATCCTGGGCCTGGGCCTGGTGCTGGGGC
TGCTGGGCCCCCTGGCCATCCTGCTGGCCCTGTACCTGCTCCGGAGGGACCAGAGGCTGC
CCCCCGATGCCCACAAGCCCCCTGGGGGAGGCAGTTTCCGGACCCCCATCCAAGAGGAGC
AGGCCGACGCCCACTCCACCCTGGCCAAGATCTGACCTGGGCCCACCAAGGTGGACGCTG
GGCCCCGCCAGGCTGGAGCCCGGAGGGTCTGCTGGGCGAGCAGGGCAGGTGCAGGCCGCC
TGCCCCGCCACGCTCCTGGGCCAACTCTGCACCGTTCTAGGTGCCGATGGCTGCCTCCGG
CTCTCTGCTTACGTATGCCATGCATACCTCCTGCCCCGCGGGACCACAATAAAAACCTTG
GCAGACGGGA
Restriction Sites Please inquire     
ACCN NM_003327
Insert Size 1100 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_003327.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_003327.2, NP_003318.1
RefSeq Size 1084 bp
RefSeq ORF 834 bp
Locus ID 7293
UniProt ID P43489
Domains TNFR
Protein Families Transmembrane
Protein Pathways Cytokine-cytokine receptor interaction
Gene Summary The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor has been shown to activate NF-kappaB through its interaction with adaptor proteins TRAF2 and TRAF5. Knockout studies in mice suggested that this receptor promotes the expression of apoptosis inhibitors BCL2 and BCL2lL1/BCL2-XL, and thus suppresses apoptosis. The knockout studies also suggested the roles of this receptor in CD4+ T cell response, as well as in T cell-dependent B cell proliferation and differentiation. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...