MMP14 (NM_004995) Human Untagged Clone
CAT#: SC116990
MMP14 (untagged)-Human matrix metallopeptidase 14 (membrane-inserted) (MMP14)
CNY 6,512.00
Cited in 6 publications. |
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MMP-14; MMP-X1; MT-MMP; MT-MMP 1; MT1-MMP; MT1MMP; MTMMP1; WNCHRS |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene ORF sequence for NM_004995 edited
ATGTCTCCCGCCCCAAGACCCTCCCGTTGTCTCCTGCTCCCCCTGCTCACGCTCGGCACC GCGCTCGCCTCCCTCGGCTCGGCCCAAAGCAGCAGCTTCAGCCCCGAAGCCTGGCTACAG CAATATGGCTACCTGCCTCCCGGGGACCTACGTACCCACACACAGCGCTCACCCCAGTCA CTCTCAGCGGCCATCGCTGCCATGCAGAAGTTTTACGGCTTGCAAGTAACAGGCAAAGCT GATGCAGACACCATGAAGGCCATGAGGCGCCCCCGATGTGGTGTTCCAGACAAGTTTGGG GCTGAGATCAAGGCCAATGTTCGAAGGAAGCGCTACGCCATCCAGGGTCTCAAATGGCAA CATAATGAAATCACTTTCTGCATCCAGAATTACACCCCCAAGGTGGGCGAGTATGCCACA TACGAGGCCATTCGCAAGGCGTTCCGCGTGTGGGAGAGTGCCACACCACTGCGCTTCCGC GAGGTGCCCTATGCCTACATCCGTGAGGGCCATGAGAAGCAGGCCGACATCATGATCTTC TTTGCCGAGGGCTTCCATGGCGACAGCACGCCCTTCGATGGTGAGGGCGGCTTCCTGGCC CATGCCTACTTCCCAGGCCCCAACATTGGAGGAGACACCCACTTTGACTCTGCCGAGCCT TGGACTGTCAGGAATGAGGATCTGAATGGAAATGACATCTTCCTGGTGGCTGTGCACGAG CTGGGCCATGCCCTGGGGCTCGAGCATTCCAGTGACCCCTCGGCCATCATGGCACCCTTT TACCAGTGGATGGACACGGAGAATTTTGTGCTGCCCGATGATGACCGCCGGGGCATCCAG CAACTTTATGGGGGTGAGTCAGGGTTCCCCACCAAGATGCCCCCTCAACCCAGGACTACC TCCCGGCCTTCTGTTCCTGATAAACCCAAAAACCCCACCTATGGGCCCAACATCTGTGAC GGGAACTTTGACACCGTGGCCATGCTCCGAGGGGAGATGTTTGTCTTCAAGGAGCGCTGG TTCTGGCGGGTGAGGAATAACCAAGTGATGGATGGATACCCAATGCCCATTGGCCAGTTC TGGCGGGGCCTGCCTGCGTCCATCAACACTGCCTACGAGAGGAAGGATGGCAAATTCGTC TTCTTCAAAGGAGACAAGCATTGGGTGTTTGATGAGGCGTCCCTGGAACCTGGCTACCCC AAGCACATTAAGGAGCTGGGCCGAGGGCTGCCTACCGACAAGATTGATGCTGCTCTCTTC TGGATGCCCAATGGAAAGACCTACTTCTTCCGTGGAAACAAGTACTACCGTTTCAACGAA GAGCTCAGGGCAGTGGATAGCGAGTACCCCAAGAACATCAAAGTCTGGGAAGGGATCCCT GAGTCTCCCAGAGGGTCATTCATGGGCAGCGATGAAGTCTTCACTTACTTCTACAAGGGG AACAAATACTGGAAATTCAACAACCAGAAGCTGAAGGTAGAACCGGGCTACCCCAAGTCA GCCCTGAGGGACTGGATGGGCTGCCCATCGGGAGGCCGGCCGGATGAGGGGACTGAGGAG GAGACGGAGGTGATCATCATTGAGGTGGACGAGGAGGGCGGCGGGGCGGTGAGCGCGGCT GCCGTGGTGCTGCCCGTGCTGCTGCTGCTCCTGGTGCTGGCGGTGGGCCTTGCAGTCTTC TTCTTCAGACGCCATGGGACCCCCAGGCGACTGCTCTACTGCCAGCGTTCCCTGCTGGAC AAGGTCTGA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | NotI-NotI |
ACCN | NM_004995 |
Insert Size | 3500 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_004995.2, NP_004986.1 |
RefSeq Size | 3558 bp |
RefSeq ORF | 1749 bp |
Locus ID | 4323 |
UniProt ID | P50281 |
Domains | hemopexin, Peptidase_M10, ZnMc |
Protein Families | Druggable Genome, Protease, Transmembrane |
Protein Pathways | GnRH signaling pathway |
Gene Summary | Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. However, the protein encoded by this gene is a member of the membrane-type MMP (MT-MMP) subfamily; each member of this subfamily contains a potential transmembrane domain suggesting that these proteins are expressed at the cell surface rather than secreted. This protein activates MMP2 protein, and this activity may be involved in tumor invasion. [provided by RefSeq, Jul 2008] |
Citations (6)
The use of this cDNA Clones has been cited in the following citations: |
---|
The cytoplasmic domain of MT1-MMP is dispensable for migration augmentation but necessary to mediate viability of MCF-7 breast cancer cells
,Cepeda, MA;Pelling, JJ;Evered, CL;Leong, HS;Damjanovski, S;,
Exp. Cell Res.
,PubMed ID 27889376
[MMP14]
|
Less is more: low expression of MT1-MMP is optimal to promote migration and tumourigenesis of breast cancer cells
,Cepeda, MA;Pelling, JJ;Evered, CL;Williams, KC;Freedman, Z;Stan, I;Willson, JA;Leong, HS;Damjanovski, S;,
Mol. Cancer
,PubMed ID 27756325
[MMP14]
|
Peptides do not prevent cleavage of endoglin to produce soluble endoglin
,Hastie, R;Tong, S;Cannon, P;Brownfoot, F;,
Pregnancy Hypertension: An International Journal of Women's Cardiovascular Health
[MMP14]
|
Endothelial cell lumen and vascular guidance tunnel formation requires MT1-MMP–dependent proteolysis in 3-dimensional collagen matrices
,Amber N. Stratman, W. Brian Saunders, Anastasia Sacharidou, Wonshill Koh, Kevin E. Fisher, David C. Zawieja, Michael J. Davis, and George E. Davis,
Blood, Jul 2009; 114: 237 - 247.
[MMP14]
|
Endothelial cell lumen and vascular guidance tunnel formation requires MT1-MMP-dependent proteolysis in 3D collagen matrices
,Amber N. Stratman, W. Brian Saunders, Anastasia Sacharidou, Wonshill Koh, Kevin E. Fisher, David C. Zawieja, Michael J. Davis, and George E. Davis,
Blood, Apr 2009; 10.1182/blood-2008-12-196451
[MMP14]
|
Macrophages Produce TGF-ß-Induced (ß-ig-h3) following Ingestion of Apoptotic Cells and Regulate MMP14 Levels and Collagen Turnover in Fibroblasts
,Zachary A. Cooper, Michael P. Gillmeister, Nevins W. Todd, and Sergei P. Atamas,
J. Cell Sci., Apr 2008; 121: 989 - 1001.
[MMP14]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC208917 | MMP14 (Myc-DDK-tagged)-Human matrix metallopeptidase 14 (membrane-inserted) (MMP14) |
CNY 6,496.00 |
|
RC208917L1 | Lenti ORF clone of Human matrix metallopeptidase 14 (membrane-inserted) (MMP14), Myc-DDK-tagged |
CNY 8,896.00 |
|
RC208917L2 | Lenti ORF clone of Human matrix metallopeptidase 14 (membrane-inserted) (MMP14), mGFP tagged |
CNY 8,896.00 |
|
RC208917L3 | Lenti ORF clone of Human matrix metallopeptidase 14 (membrane-inserted) (MMP14), Myc-DDK-tagged |
CNY 8,896.00 |
|
RC208917L4 | Lenti ORF clone of Human matrix metallopeptidase 14 (membrane-inserted) (MMP14), mGFP tagged |
CNY 8,896.00 |
|
RG208917 | MMP14 (tGFP-tagged) - Human matrix metallopeptidase 14 (membrane-inserted) (MMP14) |
CNY 8,096.00 |