C12orf43 (NM_022895) Human Untagged Clone
CAT#: SC112394
C12orf43 (untagged)-Human chromosome 12 open reading frame 43 (C12orf43)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | Custos |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_022895, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCGCCCAGTGGCACAGTGAGCGATTCGGAAAGTAGTAACAGCAGTAGCGATGCGGAGGAGCTGG AGCGGTGCCGCGAGGCGGCAATGCCGGCTTGGGGCTTGGAGCAACGCCCGCACGTGGCAGGGAAGCCAAG AGCCGGTGCTGCAAATAGCCAGTTGTCAACCTCCCAACCGAGCCTCAGGCATAAGGTGAATGAGCATGAA CAAGATGGCAACGAGCTTCAGACCACCCCTGAATTCCGAGCCCACGTAGCCAAGAAGCTGGGAGCCCTGC TGGACAGCTTCATTACCATCTCAGAAGCAGCAAAGGAGCCAGCAAAAGCTAAGGTACAGAAAGTCGCTTT GGAGGATGATGGTTTCCGCCTTTTCTTCACATCTGTCCCTGGAGGCCGTGAGAAGGAAGAGTCTCCCCAA CCCCGCCGAAAGCGACAGCCCTCCAGCTCCAGTGAGGACAGTGACGAGGAGTGGCGGCGGTGCCGGGAGG CAGCTGTGTCGGCGTCCGACATCCTACAGGAGTCAGCCATCCACAGCCCTGGAACAGTGGAGAAGGAGGC AAAGAAGAAAAGGAAGTTGAAAAAGAAAGCCAAGAAGGTGGCCAGTGTCGACTCGGCTGTCGCTGCCACC ACCCCCACCAGCATGGCCACAGTCCAGAAGCAGAAGTCAGGTGAGCTCAACGGGGACCAGGTGTCGCTTG GGACCAAAAAGAAGAAAAAGGCAAAGAAGGCCAGCGAGACCTCTCCATTCCCACCAGCAAAGAGTGCTAC AGCTATACCTGCAAACTGA |
Restriction Sites | NotI-NotI |
ACCN | NM_022895 |
Insert Size | 2430 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_022895.1, NP_075046.1 |
RefSeq Size | 1920 bp |
RefSeq ORF | 789 bp |
Locus ID | 64897 |
UniProt ID | Q96C57 |
Gene Summary | Plays a role in the regulation of Wnt signaling pathway during early development.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) uses an alternate splice site at a coding exon, but maintains the reading frame, compared to variant 1. The encoded isoform (c) is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204834 | C12orf43 (Myc-DDK-tagged)-Human chromosome 12 open reading frame 43 (C12orf43) |
CNY 2,400.00 |
|
RC204834L3 | Lenti ORF clone of Human chromosome 12 open reading frame 43 (C12orf43), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC204834L4 | Lenti ORF clone of Human chromosome 12 open reading frame 43 (C12orf43), mGFP tagged |
CNY 5,890.00 |
|
RG204834 | C12orf43 (tGFP-tagged) - Human chromosome 12 open reading frame 43 (C12orf43) |
CNY 4,000.00 |
其它C12orf43产品