IFI6 (NM_022873) Human Untagged Clone
CAT#: SC112388
IFI6 (untagged)-Human interferon, alpha-inducible protein 6 (IFI6), transcript variant 3
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | 6-16; FAM14C; G1P3; IFI-6-16; IFI616 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>SC112388 representing NM_022873.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCGGCAGAAGGCGGTATCGCTTTTCTTGTGCTACCTGCTGCTCTTCACTTGCAGTGGGGTGGAGGCA GGTGAGAATGCGGGTAAGGATGCAGGTAAGAAAAAGTGCTCGGAGAGCTCGGACAGCGGCTCCGGGTTC TGGAAGGCCCTGACCTTCATGGCCGTCGGAGGAGGACTCGCAGTCGCCGGGCTGCCCGCGCTGGGCTTC ACCGGCGCCGGCATCGCGGCCAACTCGGTGGCTGCCTCGCTGATGAGCTGGTCTGCGATCCTGAATGGG GGCGGCGTGCCCGCCGGGGGGCTAGTGGCCACGCTGCAGAGCCTCGGGGCTGGTGGCAGCAGCGTCGTC ATAGGTAATATTGGTGCCCTGATGGGCTACGCCACCCACAAGTATCTCGATAGTGAGGAGGATGAGGAG TAG |
Restriction Sites | NotI-NotI |
ACCN | NM_022873 |
Insert Size | 417 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_022873.1 |
RefSeq Size | 841 bp |
RefSeq ORF | 417 bp |
Locus ID | 2537 |
UniProt ID | P09912 |
Protein Families | Transmembrane |
MW | 13.7 kDa |
Gene Summary | This gene was first identified as one of the many genes induced by interferon. The encoded protein may play a critical role in the regulation of apoptosis. A minisatellite that consists of 26 repeats of a 12 nucleotide repeating element resembling the mammalian splice donor consensus sequence begins near the end of the second exon. Alternatively spliced transcript variants that encode different isoforms by using the two downstream repeat units as splice donor sites have been described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) uses an alterative, in-frame splice site compared to variant 1. The encoded isoform (c) is longer than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213048 | IFI6 (Myc-DDK-tagged)-Human interferon, alpha-inducible protein 6 (IFI6), transcript variant 3 |
CNY 3,705.00 |
|
RC213048L3 | Lenti ORF clone of Human interferon, alpha-inducible protein 6 (IFI6), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC213048L4 | Lenti ORF clone of Human interferon, alpha-inducible protein 6 (IFI6), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG213048 | IFI6 (tGFP-tagged) - Human interferon, alpha-inducible protein 6 (IFI6), transcript variant 3 |
CNY 4,370.00 |