IFI6 (NM_022873) Human Untagged Clone

CAT#: SC112388

IFI6 (untagged)-Human interferon, alpha-inducible protein 6 (IFI6), transcript variant 3



  "NM_022873" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-IFI6 antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 6-16; FAM14C; G1P3; IFI-6-16; IFI616
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>SC112388 representing NM_022873.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCGGCAGAAGGCGGTATCGCTTTTCTTGTGCTACCTGCTGCTCTTCACTTGCAGTGGGGTGGAGGCA
GGTGAGAATGCGGGTAAGGATGCAGGTAAGAAAAAGTGCTCGGAGAGCTCGGACAGCGGCTCCGGGTTC
TGGAAGGCCCTGACCTTCATGGCCGTCGGAGGAGGACTCGCAGTCGCCGGGCTGCCCGCGCTGGGCTTC
ACCGGCGCCGGCATCGCGGCCAACTCGGTGGCTGCCTCGCTGATGAGCTGGTCTGCGATCCTGAATGGG
GGCGGCGTGCCCGCCGGGGGGCTAGTGGCCACGCTGCAGAGCCTCGGGGCTGGTGGCAGCAGCGTCGTC
ATAGGTAATATTGGTGCCCTGATGGGCTACGCCACCCACAAGTATCTCGATAGTGAGGAGGATGAGGAG
TAG

Restriction Sites NotI-NotI     
ACCN NM_022873
Insert Size 417 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_022873.1
RefSeq Size 841 bp
RefSeq ORF 417 bp
Locus ID 2537
UniProt ID P09912
Protein Families Transmembrane
MW 13.7 kDa
Gene Summary This gene was first identified as one of the many genes induced by interferon. The encoded protein may play a critical role in the regulation of apoptosis. A minisatellite that consists of 26 repeats of a 12 nucleotide repeating element resembling the mammalian splice donor consensus sequence begins near the end of the second exon. Alternatively spliced transcript variants that encode different isoforms by using the two downstream repeat units as splice donor sites have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) uses an alterative, in-frame splice site compared to variant 1. The encoded isoform (c) is longer than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...