CBFB (NM_022845) Human Untagged Clone
CAT#: SC110848
CBFB (untagged)-Human core-binding factor, beta subunit (CBFB), transcript variant 1
CNY 2,400.00
CNY 3,990.00
Cited in 1 publication. |
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PEBP2B |
Vector | pCMV6-XL6 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF within SC110848 sequence for NM_022845 edited (data generated by NextGen Sequencing)
ATGCCGCGCGTCGTGCCCGACCAGAGAAGCAAGTTCGAGAACGAGGAGTTTTTTAGGAAG CTGAGCCGCGAGTGTGAGATTAAGTACACGGGCTTCAGGGACCGGCCCCACGAGGAACGC CAGGCACGCTTCCAGAACGCCTGCCGCGACGGCCGCTCGGAAATCGCTTTTGTGGCCACA GGAACCAATCTGTCTCTCCAGTTTTTTCCGGCCAGCTGGCAGGGAGAACAGCGACAAACA CCTAGCCGAGAGTATGTCGACTTAGAAAGAGAAGCAGGCAAGGTATATTTGAAGGCTCCC ATGATTCTGAATGGAGTCTGTGTTATCTGGAAAGGCTGGATTGATCTCCAAAGACTGGAT GGTATGGGCTGTCTGGAGTTTGATGAGGAGCGAGCCCAGCAGGAGGATGCATTAGCACAA CAGGCCTTTGAAGAGGCTCGGAGAAGGACACGCGAATTTGAAGATAGAGACAGGTCTCAT CGGGAGGAAATGGAGGCAAGAAGACAACAAGACCCTAGTCCTGGTTCCAATTTAGGTGGT GGTGATGACCTCAAACTTCGTTAA Clone variation with respect to NM_022845.2 |
Restriction Sites | Please inquire |
ACCN | NM_022845 |
Insert Size | 3000 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_022845.2, NP_074036.1 |
RefSeq Size | 3150 bp |
RefSeq ORF | 564 bp |
Locus ID | 865 |
UniProt ID | Q13951 |
Domains | CBF_beta |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | The protein encoded by this gene is the beta subunit of a heterodimeric core-binding transcription factor belonging to the PEBP2/CBF transcription factor family which master-regulates a host of genes specific to hematopoiesis (e.g., RUNX1) and osteogenesis (e.g., RUNX2). The beta subunit is a non-DNA binding regulatory subunit; it allosterically enhances DNA binding by alpha subunit as the complex binds to the core site of various enhancers and promoters, including murine leukemia virus, polyomavirus enhancer, T-cell receptor enhancers and GM-CSF promoters. Alternative splicing generates two mRNA variants, each encoding a distinct carboxyl terminus. In some cases, a pericentric inversion of chromosome 16 [inv(16)(p13q22)] produces a chimeric transcript consisting of the N terminus of core-binding factor beta in a fusion with the C-terminal portion of the smooth muscle myosin heavy chain 11. This chromosomal rearrangement is associated with acute myeloid leukemia of the M4Eo subtype. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) encodes the longest isoform (1). |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
RUNX binding sites are enriched in herpesvirus genomes and RUNX1 overexpression leads to HSV-1 suppression
,Kim, DJ;Khoury-Hanold, W;Jain, PC;Klein, J;Kong, Y;Pope, SD;Ge, W;Medzhitov, R;Iwasaki, A;,
J. Virol.
,PubMed ID 32878886
[CBFB]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211623 | CBFB (Myc-DDK-tagged)-Human core-binding factor, beta subunit (CBFB), transcript variant 1 |
CNY 2,400.00 |
|
RC211623L1 | Lenti ORF clone of Human core-binding factor, beta subunit (CBFB), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC211623L2 | Lenti ORF clone of Human core-binding factor, beta subunit (CBFB), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC211623L3 | Lenti ORF clone of Human core-binding factor, beta subunit (CBFB), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC211623L4 | Lenti ORF clone of Human core-binding factor, beta subunit (CBFB), transcript variant 1, mGFP tagged |
CNY 4,800.00 |
|
RG211623 | CBFB (tGFP-tagged) - Human core-binding factor, beta subunit (CBFB), transcript variant 1 |
CNY 4,000.00 |