POLR2J2 (NM_032959) Human Untagged Clone

CAT#: SC110811

POLR2J2 (untagged)-Human polymerase (RNA) II (DNA directed) polypeptide J2 (POLR2J2)



  "NM_032959" in other vectors (4)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
POLR2J2 mouse monoclonal antibody, clone OTI3G4 (formerly 3G4)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HRPB11B; POLR2J3; RPB11b1; RPB11b2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC110811 sequence for NM_032959 edited (data generated by NextGen Sequencing)
ATGAACGCCCCTCCAGCCTTCGAGTCGTTCTTGCTCTTCGAGGGCGAGAAGATCACCATT
AACAAGGACACCAAGGTACCCAATGCCTGTTTATTCACCATGAACAAAGAAGACCACACA
CTGGGAAACATCATTAAATCACAACTCCTAAAAGACCCGCAAGTGCTATTTGCTGGCTAC
AAAGTCCCCCACCCCTTGGAGCACAAGATCATCATCCGAGTGCAGACCACGCCGGACTAC
AGCCCCCAGGAAGCCTTTACCAACGCCATCACCGACCTCATCAGCGAGCTGTCCCTGCTG
GAGGAGCGCTTCCGGACGTGCCTGCTTCCCCTTCGCCTTCTGCCGTGA

Clone variation with respect to NM_032959.5
84 g=>t;90 c=>t;102 c=>g;285 t=>c
>OriGene 5' read for NM_032959 unedited
TTGTATACGACTCATATAGGCGGCCGCGACATTCGCACGAGGGGACACTTGGGGTCTGGA
CGCAACGGCGGCGGGAGCATGAACGCCCCTCCAGCCTTTCGAGTCGTTCTTGCTCTTCGA
GGGCGAGAAGATCACCATTAACAAGGACACCAAGGTACCCAATGCCTGTTTATTCACCAT
GAACAAAGAAGACCACACACTGGGAAACATCATTAAATCACAACTCCTAAAAGACCCGCA
AGTGCTATTTGCTGGCTACAAAGTCCCCCACCCCTTGGAGCACAAGATCATCATCCGAGT
GCAGACCACGCCGGACTACAGCCCCCAGGAAGCCTTTACCAACGCCATCACCGACCTCAT
CAGCGAGCTGTCCCTGCTGGAGGAGCGCTTCCGGACGTGCCTGCTTCCCCTTCGCCTTCT
GCCGTGATTGTCAGTTTCCTGAGGCCTCCCCAGCCACGCTTCCTGTACAGCCTGCAGAAC
TTCTGGCATGGAAAAGCCCCTGTGCAACTGGTAAAGATATCAATAAGCACCAGGAGGTAT
CTAAATCCACCAGGAGCCATAGGCATCACGNTTGACGTCCATTTACCAGTCTTCCCTGGC
AAGATTCTTCTGAATTGTGCTGCCTTGCCAAAGAAGTTTGGAAGGGGCCTGGGCCCAATG
GGCTTGGGCCTTGAATCCCAACATTTTGGGAAACAATTCAAGTGGGATGTTATAAGGGCA
AAGGGGTTCAGAACATCCTGTCCAACATGGTGACATTCCATCTCTACTAAAATACATAAG
TAACTGGNNTTGNNNGNNNGGGGGGCCCCGGTGATCCCCCCTCCTCCAAAAGGTGAGGGC
AGATAATCGCTTGACCTGGAGGGAAGAGGGGGGGGGGGGACCNAAAAATATGGCCTTTTG
CTCCCACGGGGGGAAAAAAAGGAAAAACTCCCTTAA
Restriction Sites NotI-NotI     
ACCN NM_032959
Insert Size 2060 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_032959.3, NP_116581.3
RefSeq Size 1727 bp
RefSeq ORF 348 bp
Locus ID 246721
UniProt ID Q9GZM3
Domains RNA_pol_L
Protein Families Transcription Factors
Protein Pathways Huntington's disease, Metabolic pathways, Purine metabolism, Pyrimidine metabolism, RNA polymerase
Gene Summary This gene is a member of the RNA polymerase II subunit 11 gene family, which includes three genes in a cluster on chromosome 7q22.1 and a pseudogene on chromosome 7p13. The founding member of this family, DNA directed RNA polymerase II polypeptide J, has been shown to encode a subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. This locus produces multiple, alternatively spliced transcripts that potentially express isoforms with distinct C-termini compared to DNA directed RNA polymerase II polypeptide J. Most or all variants are spliced to include additional non-coding exons at the 3' end which makes them candidates for nonsense-mediated decay (NMD). Consequently, it is not known if this locus expresses a protein or proteins in vivo. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...