WFDC3 (NM_181522) Human Untagged Clone

CAT#: SC110795

WFDC3 (untagged)-Human WAP four-disulfide core domain 3 (WFDC3), transcript variant 2



CNY 1,200.00

CNY 6,270.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


WFDC3 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms dJ447F3.3; OTTHUMP00000196627; protease inhibitor WAP14; WAP14; WAP14, dJ447F3.3; WAP four-disulfide core domain 3; whey acidic protein 14
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC110795 sequence for NM_181522 edited (data generated by NextGen Sequencing)
ATGGATGAGAATTGTCAAGCTGGAGAAAAATGTTGCAAGTCAGGCTGTGGCCGCTTCTGT
GTCCCACCAGTCCTGCCCCCAAAACTGACCATGAACCCCAACTGGACTGTGAGGTCTGAT
TCCGAATTAGAGATCCCGGTGCCCTAG

Clone variation with respect to NM_181522.1
>OriGene 5' read for NM_181522 unedited
AATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGTGCTCGTCCGCCCGGAAGC
GCGACGCTGGAGCTGCGGGGTTACCATGGGAACCGAACCGCCGCGCCTCGCCCAGGACAG
TTACACTTAGAGGCCTTGGAGGAAAAGAGATTGCCCTAGGGTTATTCGGAAACAATCCTG
TTTGAAAAGGTGCATCACTGATGAGACATGTCCAGGTGTAAAGAAATGCTGCACGCTTGG
CTGCAACAAGAGCTGTGTAGTCCCAATCTCTAAACAGAAGCTGGGGCGGGGCGGTGATTG
TCCAAAAGTTCTGGTGGGCCTGTGCATTGTTGGCTGTGTGATGGATGAGAATTGTCAAGC
TGGAGAAAAATGTTGCAAGTCAGGCTGTGGCCGCTTCTGTGTCCCACCAGTCCTGCCCCC
AAAACTGACCATGAACCCCAACTGGACTGTGAGGTCTGATTCCGAATTAGAGATCCCGGT
GCCCTAGCTGTGCTGATTTGTCTGGAGCTTCTTTGGAAGAGGACACCCACCCTGGTACCT
GGTCCCTGGCGAGAGGCTGGAGTGAAGTANCATGATCTCGGCTCACTGCAACATCCACCC
CCTGGATTCAAGCAATTCTCCTGCCTCAATATTNTAGCATTNTATCCTTTCTCGTCTCAT
TAAAAGGTGACAGNCAGAAAAGTGACTCTTTTTTCATTGTGTCTCCCAGTATCCTTATGA
CTTGTATAGCCCTACTGACTACTGATCTTNCACCATCTCTGCTGGATGACTGAAAGAGAA
CTCCAGCAGAAATTGCAGAATCCATAGCATTGTATTNTTGACAGTTTATTCTGGCTCATT
GGGCCAATNNCTGCTCTTACTTTCATCTTATTACTCCTGGGGAGAGTGGACTATCATCAT
AAG
Restriction Sites NotI-NotI     
ACCN NM_181522
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_181522.1, NP_852663.1
RefSeq Size 776 bp
RefSeq ORF 147 bp
Locus ID 140686
Protein Families Secreted Protein
Gene Summary This gene encodes a member of the WAP-type four-disulfide core (WFDC) domain family. The WFDC domain, or WAP signature motif, contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor. The encoded protein contains four WFDC domains. Most WFDC genes are localized to chromosome 20q12-q13 in two clusters: centromeric and telomeric. This gene belongs to the telomeric cluster. Alternatively spliced transcript variants have been observed but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks two internal exons, and uses a downstream translation start codon, as compared to variant 1. It encodes isoform 2, which lacks the signal peptide and WFDC domains.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...