hnRNP A1 (HNRNPA1) (NM_031157) Human Untagged Clone

CAT#: SC109309

HNRNPA1 (untagged)-Human heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1), transcript variant 2



  "NM_031157" in other vectors (6)

CN¥ 3,656.00

CN¥ 6,080.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
hnRNP A1 Rabbit polyclonal Antibody
    • 100 ul

CN¥ 1,999.00
CN¥ 3,280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ALS19; ALS20; hnRNP-A1; hnRNP A1; HNRPA1; HNRPA1L3; IBMPFD3; UP 1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_031157 edited
TTCACCCTGCCGTCATGTCTAAGTCAGAGTCTCCTAAAGAGCCCGAACAGCTGAGGAAGC
TCTTCATTGGAGGGTTGAGCTTTGAAACAACTGATGAGAGCCTGAGGAGCCATTTTGAGC
AATGGGGAACGCTCACGGACTGTGTGGTAATGAGAGATCCAAACACCAAGCGCTCCAGGG
GCTTTGGGTTTGTCACATATGCCACTGTGGAGGAGGTGGATGCAGCTATGAATGCAAGGC
CACACAAGGTGGATGGAAGAGTTGTGGAACCAAAGAGAGCTGTCTCCAGAGAAGATTCTC
AAAGACCAGGTGCCCACTTAACTGTGAAAAAGATATTTGTTGGTGGCATTAAAGAAGACA
CTGAAGAACATCACCTAAGAGATTATTTTGAACAGTATGGAAAAATTGAAGTGATTGAAA
TCATGACTGACCGAGGCAGTGGCAAGAAAAGGGGCTTTGCCTTTGTAACCTTTGACGACC
ATGACTCCGTGGATAAGATTGTCATTCAGAAATACCATACTGTGAATGGCCACAACTGTG
AAGTTAGAAAAGCCCTGTCAAAGCAAGAGATGGCTAGTGCTTCATCCAGCCAAAGAGGTC
GAAGTGGTTCTGGAAACTTTGGTGGTGGTCGTGGAGGTGGTTTCGGTGGGAATGACAACT
TCGGTCGTGGAGGAAACTTCAGTGGTCGTGGTGGCTTTGGTGGCAGCCGTGGTGGTGGTG
GATATGGTGGCAGTGGGGATGGCTATAATGGATTTGGTAATGATGGTGGTTATGGAGGAG
GCGGCCCTGGTTACTCTGGAGGAAGCAGAGGCTATGGAAGTGGTGGACAGGGTTATGGAA
ACCAGGGCAGTGGCTATGGCGGGAGTGGCAGCTATGACAGCTATAACAACGGAGGCGGAG
GCGGCTTTGGCGGTGGTAGTGGAAGCAATTTTGGAGGTGGTGGAAGCTACAATGATTTTG
GGAATTACAACAATCAGTCTTCAAATTTTGGACCCATGAAGGGAGGAAATTTTGGAGGCA
GAAGCTCTGGCCCCTATGGCGGTGGAGGCCAATACTTTGCAAAACCACGAAACCAAGGTG
GCTATGGCGGTTTCAGCAGCAGCAGTAGCTATGGCAGTGGCAGAAGATTTTAATTAGGAA
ACAAAGCTT
Restriction Sites Please inquire     
ACCN NM_031157
Insert Size 1200 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_031157.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_031157.1, NP_112420.1
RefSeq Size 1925 bp
RefSeq ORF 1119 bp
Locus ID 3178
UniProt ID P09651
Domains RRM
Protein Pathways Spliceosome
Gene Summary This gene encodes a member of a family of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs), which are RNA-binding proteins that associate with pre-mRNAs in the nucleus and influence pre-mRNA processing, as well as other aspects of mRNA metabolism and transport. The protein encoded by this gene is one of the most abundant core proteins of hnRNP complexes and plays a key role in the regulation of alternative splicing. Mutations in this gene have been observed in individuals with amyotrophic lateral sclerosis 20. Multiple alternatively spliced transcript variants have been found. There are numerous pseudogenes of this gene distributed throughout the genome. [provided by RefSeq, Feb 2016]
Transcript Variant: This variant (2, also known as A1B) contains an alternate in-frame exon compared to variant 1, resulting in a longer protein (isoform b) than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...